Dataset for CDS BCL-2-like of organism all

[Download (right click)] [Alignment] [Repertoires]

512 sequence(s)

>gnl|bcl2dbcds|G1L3M8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=MCL-1 (length=1005 residues).
atgtttggcctcaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggttgggggccggcagcggcgg
gggggnatcgggagggcggcttttggcttcggggaaggaggccacggcccggagggagatagggggaggggaagccggtg
cggtgattggcggaagcgccggcgctagtcccccggntggcgccgagggtcccgacgtcacggcgacccccccgaggcta
ctgttcctcgagcccacccgccgcgcgtcgccgcctgaagagatggaaggcccagccgccgacgccatcatgtcgcccga
agaggagctggacgggtacgagccggaacctttggggaagcggccggctgtcctgcctttgctggagttggtcggggagg
ccagcggtggcccttgtacggacggctcactgccctcgacgccacccccagcagaggaggaggaagacgagttgtaccgg
cagtcgctggagattatctctcggtaccttcgggagcaggcaacaggcgccaaggacgcgaaaccgctgggcgggtctgg
ggcggccagccggaaggcgttagagaccctccgacgggtcggggacggggtacagcgcaaccacgagacggccttccaag
gcatgcttcggaaactggacatcaaaaatgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgac
ggagtaacaaactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaacca
agaaggctgcatcgaaccattagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaa
gaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgca
ggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|G1L3M8_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=MCL-1 (length=1041 residues).
atgtttggcctcaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggttgggggccggcagcggcgg
gggggnatcgggagggcggcttttggcttcggggaaggaggccacggcccggagggagatagggggaggggaagccggtg
cggtgattggcggaagcgccggcgctagtcccccggccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntggc
gccgagggtcccgacgtcacggcgacccccccgaggctactgttcctcgagcccacccgccgcgcgtcgccgcctgaaga
gatggaaggcccagccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggaacctttggggaagc
ggccggctgtcctgcctttgctggagttggtcggggaggccagcggtggcccttgtacggacggctcactgccctcgacg
ccacccccagcagaggaggaggaagacgagttgtaccggcagtcgctggagattatctctcggtaccttcgggagcaggc
aacaggcgccaaggacgcgaaaccgctgggcgggtctggggcggccagccggaaggcgttagagaccctccgacgggtcg
gggacggggtacagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaatgaagacgatgtc
aaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactcttatttcttt
tggtgcctttgtggccaaacacttgaagagtataaaccaagaaggctgcatcgaaccattagcagaaagcatcacagatg
ttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggac
ctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataag
a
>gnl|bcl2dbcds|G1LID1_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL-2 (length=489 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcggcccccgccgccgccgccgccgcgggccctgcgctcagccccgtgccacctgtgg
tccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgacttcgcggagatgtccagccagctg
cacctgacacccttcaccgcaaggggacgctttgccacggtggtggaggagctcttcagggatggggtgaactgggggag
gattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggacaaca
ttgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggacaacggaggctgggtaggtgcacgt
ccgcttgaa
>gnl|bcl2dbcds|G1LID1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL-2 (length=549 residues).
ccccaccccgcagcgtccccccggcccttcgtgaggcgctggcaggtggcgccgccaagcgccgccgccgccgccgcggg
ccctgcgctcagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgcc
gcgacttcgcggagatgtccagccagctgcacctgacacccttcaccgcaaggggacgctttgccacggtggtggaggag
ctcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaa
ccgggagatgtcgcccctggtggacaacattgccctgtggatgactgagtacctgaaccggcacctgcacacctggatcc
aggacaacggaggctgggatgcctttgtggagttgtacggccccagcatgcagcctctgtttgacttctcctggctgtct
ctgaaggccctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctacctgggccacaag
>gnl|bcl2dbcds|G1LKR4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL2L10 (length=582 residues).
atggcggacgcgttgaggggcacggcgcggctgctgaccgactacctggagtactgcgcccgggagcccggcacccctgc
gcgggcgccgtccacgcccgaggccgcggtgctgcgttcggtggccgcccaggtacagcagcgtcacgagcgcttcttgt
ccgattaccgcggctacgccggcggcaaccgcgtggagctggtggctcaggtggagcgggagatactcgcccacccccag
cccctaagctggggccgtgtggtggcgctcttgaccttcgcgggcacactgctggagagatcgccgtcggggacctactc
gaacctggggccggaccaggaactggagctgggggagtgggaggccggcgtccgccaggactgccggcacctggtggact
tcctctgcaatcggctcacgggacagcatcgcgcctggctggaggcgcacgacggctgggatggcttttgtctcttcttc
acacccatgctgccgtcgtcttggaaaagactgctggcccaggctcttctgtcctgcttcacagcggtgatcttaatcta
cttctggaaaaggttattgtga
>gnl|bcl2dbcds|G1LMC3_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL2L2 (length=630 residues).
ccatatattcatgccagtctttcatccttgactcttacagccgcccggatggcgaccccagcttcagccccagacacacg
ggctctagtggcagactttgtaggctataagctgaggcagaaaggttatgtgtgtggagctggccctggggagggcccag
cagctgacccactgcaccaagccatgcgggcagctggagatgagtttgagacccgcttccggcgcaccttctctgatttg
gcagcccagctgcatgtgaccccaggctcagcccagcaacgcttcacccaggtctctgatgaactcttccaagggggccc
caactggggccgcctggtggccttctttgtctttggagccgcactgtgtgctgagagtgtcaacaaagagatggaaccac
ttgtgggacaagtgcaagagtggatggtggcctacctggagacacggctggctgactggatccacagcagtgggggctgg
gcggagttcacagctctatacggggacggggccctggaggaggcgcggcgtctgcgggaggggaactgggcctcagtgag
gacagtgctgacaggggccgtggcactgggggccctggtaactgtaggggccttttttgctagcaagtga
>gnl|bcl2dbcds|U3II49_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anas platyrhynchos GN=BCL-2 (length=312 residues).
ggactccacctcgccctgcgccaggccggggacgagttctcccgtcgctaccagcgggacttcgcccagatgtccggcca
gctgcacctgacaccnnnnacggccagaggccgcttcgtggccgtggtggaggagctcttccgagacggggtgaactggg
gccggatcgtggccttcttcgagttcggcggcgtcatgtgcgtggagagcgtcaaccgggagatgtctcccctggtggac
agcatcgccgcctggatgaccgagtacctgaaccggcacctgcacaactggatccaggacaacggaggctgg
>gnl|bcl2dbcds|U3IRH3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anas platyrhynchos GN=MCL-1 (length=465 residues).
cattttgggctggtttcacccaactcagaagcgagctcccgagccagctgcggggggggagcaggggggggtcaccgagt
ctctgagccaacctctcttgcaggaatgcttcggaagctggaaatcaagaaggaggaggacctgcaggccgtgggtgagg
tggcggcccacctcttcagcgacggggtgaccaactgggggcgcgtcgtcaccctcatctccttcggcgccttcgtcgcc
cggcacctgaaaagcgtaaagcaggagaaaagcatcggctccctggccaggatcatcaccgacctcgtctcgtccaaacg
cgagtggctcgtgagccagggaggctgggagggtttcgtcgactttttccgagtggaagacctggaaggcagcatcagga
acgtgctgatggcgttcgcaggagtggctggactgggagcgagcttggcctacatgatccggtga
>gnl|bcl2dbcds|U3IS71_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Anas platyrhynchos GN=BCL2L1 (length=681 residues).
atgtccagcggcaaccgggagctggtgatcgactttgtctcctacaagctgtcgcagaaaggctacagctggagccagct
ggaggaagaggatgagaacaggactgagttggcttccgaggccgccgcggtgctcaacgggagcccctcctggcaccccc
cagctggccaggtagtgaacggcgccgccgtgcaccggagcagcctggaggtccacgagcttgttcaatcggccgccgtc
cggcaggctctgcgcgaagccggggatgaattcgagctgaggtaccgccgggctttcagcgacctcacctcccagctcca
catcacccccggcacggcttaccagagcttcgagcaggtggtgaacgaacttttccgcgatggggtgaactgggggcgca
tcgtggccttcttctccttcggaggggcgctgtgcgtggagagcgtggacaaggagatgagggtcctggtggggcgcatc
gtggcctggatgaccacctaccggagggcagagctggagaaagcattttctgagggaggagggatggagcggtttgtgga
cctctacgggaacgatgctgctgcggagatgaggaagggccaggaaaccttcaacaaatggctcctgaccggggccacgg
tggccggagtgctcctgctgggatccctgctgagcccaagt
>gnl|bcl2dbcds|H9GHK7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Anolis carolinensis GN=BCL2L1 (length=630 residues).
atgtcgagcagtaaccgagcgctcgtggtggacttcctttcctacaagctgtcgcagcggggccacagctggcatgagat
tgagatggagagcggggaggaagcgatggagccagcaaacgagacggggaacaccctcaatgggagcccttcttggcatc
ccagccccagccatgtcatcaatggggcctcagaacaccccgaactccttgaagaggaggaggaagaaaacccgagggtg
gatgtcagccagacacttagggaggctggcgatgagtttgaactaaggtaccggcgggcttttagtgacctgacctccca
gctccacatcaccttgggcacggcataccagagcttcgagcaggtggtgaatgaactcttccacgatggggtaaactggg
ggcggatagtggcattcttctcctttgggggagccctgtgcgtggagagcgttgacaaagagatgcaagggttggtggtg
aggattgccagctggatgaccacgtacctgactgaacacctggacccctggatccaagaaaacggtggctggaaatcaaa
ggggggacaaatcatttcagttatctacacgcatcattccgaagtctgtctgaacacttacattgattga
>gnl|bcl2dbcds|H9GPE7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anolis carolinensis GN=BCL-2 (length=510 residues).
atggctcatcctgggataagaggttacgacaacagggaaatcgtgctgaggtacatccattacaagctgtcgcagaaagg
atatgactgggttgccagtggagacagaggaaagtcagcatctctttccccagagcttctcaattctgatcctgtgagta
ccaatgcccccagggaagaacctgacccggtgccacaggttgtccatacaacattacgccaagccggagatgagttctcc
cgacgctatcggagggactttgctcaaatgtctggccagctgcatttgacccccagcactgccagaagtcgttttgtggc
cgtggtggaagagctcttccaggacggtgtgaactgggggaggattgtggcgttctttgaatttggtggcatgctgtgcg
tggagagtgtcagccgggagatgtccccccttgtggacaatattgctacgtggatgactgagtatctgaaccagtacctg
cgcaactggatccaggagaacggaggctgg
>gnl|bcl2dbcds|R4GAJ0_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anolis carolinensis GN=MCL-1 (length=990 residues).
atggccccgaacacgccggcctcacctggagccggcggaggcgtcggagaaagtagcggcgggaataataacgacggcgg
cggcgtctcggttccgaaggcctcaggtcttttctcagagaggccgcgccctctgattggcggggggcctcgcgccggac
ccctgagggcgctgattggcccctgggaggggtctcagcgggcgctgattggctgcgacgctgagggagaaggagagcaa
ccaaaatggcgcccggcctccctgccgctgcctgaaggggagctcgacggctgcgaggaagccgaggaggaggaggccgc
gacggtgccgtcttccaccccctcgccggacaaagagatggcggaggaggaaggagagaaagggaaaggagggccccctc
tcttcccggaccacctgcggaagacgacgctggaagtggtaggccgctacctgcgcgaggccgccgacgaggccgggtcc
aaaggcaccgggcccaagttctccttccaaggcttgctggggcgcttcgggagcagccccaacgaggcggaggtggcgcg
cgcgctggagacgctgcgccgggtgggcgagagcctccgggagaagcacctgctggccttccaaggaatgcttagaaagt
tggaaataaagaaagaagaggacttggcgtctgtggcagaagtgacaacagaggtcttcagagatggcataataaactgg
ggccgcattgtgactctcatctcttttggtgcctttgttgccaaacacctgaagagcataaaccaagagaatgctatcaa
cactttaatagaaattatcactgatgtgctggtgacggacaagagagaatggctattgaaacataatgcctgggagggat
ttgttcagttcttccatgtagaggacatagaaggtggcatcaggaatgttctggtggcttttgccagtgtggctggaata
ggggcaggcttggcctacatgatccggtga
>gnl|bcl2dbcds|R4GAJ0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anolis carolinensis GN=MCL-1 (length=936 residues).
atgtttaacaagaaatcgatggtgctggtttgcgggggcgccccgagcatggccccgaacacgccggcctcacctggagc
cggcggaggcgtcggagaaagtagcggcgggaataataacgacggcggcggcgtctcggttccgaaggcctcaggtcttt
tctcagagaggccgcgccctctgattggcggggggcctcgcgccggacccctgagggcgctgattggcccctgggagggg
tctcagcgggcgctgattggctgcgacgctgagggagaaggagagcaaccaaaatggcgcccggcctccctgccgctgcc
tgaaggggagctcgacggctgcgaggaagccgaggaggaggaggccgcgacggtgccgtcttccaccccctcgccggaca
aagagatggcggaggaggaaggagagaaagggaaaggagggccccctctcttcccggaccacctgcggaagacgacgctg
gaagtggtaggccgctacctgcgcgaggccgccgacgaggccgggtccaaaggcaccgggcccaagttctccttccaagg
cttgctggggcgcttcgggagcagccccaacgaggcggaggtggcgcgcgcgctggagacgctgcgccgggtgggcgaga
gcctccgggagaagcacctgctggccttccaaggaatgcttagaaagttggaaataaagaaagaagaggacttggcgtct
gtggcagaagtgacaacagaggtcttcagagatggcataataaactggggccgcattgtgactctcatctcttttggtgc
ctttgttgccaaacacctgaagagcataaaccaagagaatgctatcaacactttaatagaaattatcactgatgtgctgg
tgacggacaagagagaatggctattgaaacataatgcctggcacaactgtgtctga
>gnl|bcl2dbcds|A0A2K5C7L5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=717 residues).
atgtttggcctccaaagaaacgcgctaatcggactcaacctctactgtgagtgggccggcttggggactggcagtggcgg
caccacccctccgggagggcggcttttggccacggagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgtggtgattggcggaagcgccggcgctagcccctcggccgccctcacgcctgacgcccgggggtcgtgcggccgctgc
tggttcttcgcgcccacccgccgcgcggcgccgcttgaggagatggaagccccggccgccgacgccatcatgtcgcccga
agaagagctggacaggtacgagccggagcctctcgggaagcggccggctgtcctgcccctgctggagttggtggaggagc
ctggtaatgactccagtacggatgggtcactaccctcgacgccgccgacatcactggagattatctctcggtaccttcgg
gaacaggcgactggcgccaaggacacaaagccaatggacaggtccggggccgccagcaggaaggctctggagaccttacg
acgggttggggacggcgtgcagcgcaaccacgagacggccttccaagttcttccatgtagaagacctagaaggtggcatc
agaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatagccttgtaa
>gnl|bcl2dbcds|A0A2K5CFH3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=1059 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccacggagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgctagccccccggccgccctcgtgcctgacgcccggagggtcgtgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcctgaagaagagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggagcctggtaatggctccagtacggacgggtcacta
ccctcgacgccgcctccagcggaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagcaggaaggcgctggagaccttac
gacgggttggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggtaggattgtgactct
catttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgcattgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcact
gtctcttatacacatctag
>gnl|bcl2dbcds|A0A2K5CFH3_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=600 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagca
ggaaggcgctggagaccttacgacgggttggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggtaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgca
ttgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcactgtctcttatacacatctag
>gnl|bcl2dbcds|A0A2K5CFH3_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=789 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccacggagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgctagccccccggccgccctcgtgcctgacgcccggagggtcgtgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcctgaagaagagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggagcctggtaatggctccagtacggacgggtcacta
ccctcgacgccgcctccagcggaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagcaggaaggcgctggagaccttac
gacgggttggggacggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggc
>gnl|bcl2dbcds|A0A2K5CWZ4_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L2 (length=651 residues).
atgccccttctggttctctgtccatatattcatgccagtctttcatccttgcctcttatagccgcccggatggcgacccc
agcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggttatgtctgtggag
ctggccccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagctggagatgagttcgagacccgcttc
cggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccga
tgaacttttccaagggggccctaactggggccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
tcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggctggccgactgg
atccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcggcgtctgcggga
ggggaactgggcatcagtgaggacagtgctgacaggggccgtggcactgggggccctggtaactgtaggggccttttttg
ctagcaagtga
>gnl|bcl2dbcds|A0A2K5CWZ4_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L2 (length=615 residues).
catctttcatccttgcctcttatagccgcccggatggcgaccccagcctcggccccagacacacgggctctggtggcaga
ctttgtaggttataagctgaggcagaagggttatgtctgtggagctggccccggggagggcccagcagctgacccgctgc
accaagcaatgcgggcagctggagatgagttcgagacccgcttccggcgcaccttctctgatctggcggctcagctgcat
gtgaccccaggctcagcccaacaacgcttcacccaggtctccgatgaacttttccaagggggccctaactggggccgcct
tgtagccttctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgc
aggagtggatggtggcctacctggagacgcggctggccgactggatccacagcagtgggggctgggcggagttcacagct
ctatacggggacggggccctggaggaggcgcggcgtctgcgggaggggaactgggcatcagtgaggacagtgctgacagg
ggccgtggcactgggggccctggtaactgtaggggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A2K5CWZ4_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L2 (length=1041 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaacttttccaagggggccctaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggccgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaagaactacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
gcaaatcaaggttgactttaaggctttcatttattcatctctgactcaggtgatcccgaaacgaaccaacagaccaggca
tcagcacaacagaccggggttttccacgagcccgctaccgcgcacggaccaccaactacaacagttcccgctctcgattc
tacagtggttttaacagcaggccccggggtcgcgtctacaggggccgggctagagcgacatcatggtattccccttacta
a
>gnl|bcl2dbcds|A0A2K5D2I1_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatattcacaatctaactcaggactatctgcggtacgtcctgcagataccacaatctgg
aacgggtccaagcaaaacgtccagggtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagagtctgaagc
catgcttggacaatgttaatattgtgtccatagataatgccagaatgatattcagtcaagtgatggaaaaggaatttgaa
gatggcattattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgagagcg
aattgccccggatgtggatacttacaaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taagtcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgcgaaatgctatctctcttgaagcaatactattga
>gnl|bcl2dbcds|A0A2K5D2I1_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2A1 (length=492 residues).
atgacagactgtgaatttggatatattcacaatctaactcaggactatctgcggtacgtcctgcagataccacaatctgg
aacgggtccaagcaaaacgtccagggtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagagtctgaagc
catgcttggacaatgttaatattgtgtccatagataatgccagaatgatattcagtcaagtgatggaaaaggaatttgaa
gatggcattattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgagagcg
aattgccccggatgtggatacttacaaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taagtcaaaacggaggctgggcgaaatggcacagtctcctgcttgtgctggtggagtcagtggcccagaaggagaggaaa
atggctttgtaa
>gnl|bcl2dbcds|A0A2K5DMS4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=492 residues).
atgtttggcttccaagtggtaatcagactcaacctctactgcggtgccatccctccaggaccgcggcttttggcgactgg
cgccaaggacacaaagccaatgggcaggtctgaggccgccaacagtaaggcgctggagaccttacgaggggttggggaag
gcgtgccccgcaaccacgagatggccttacaaggcatgcttcggaatctggacaacaaaaacgaagacaatgtcaaatct
ttctacggcgtaacaaactggggtaggattgtgactctcagttcttttggtgcctttgtggccaaacacttgaagaccat
aaaccaagaaagttgcatcgaaccattagcagaaagtatcagatattctcgctgggatgggtttgtggagttcttccgtg
tagaggacttagaaggtggcatcagaaatgggctgctggctttcgcaggtgttgctggagtaggaactgatttggcatat
ctaataagatag
>gnl|bcl2dbcds|A0A2K5EB04_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Aotus nancymaae GN=BCL-2 (length=723 residues).
atggcgcacgctgggagaacagggtacgataaccgagagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagatgtgggcgccgcacccccaggggccgcccccgcgccgggcatcttctcctcccagcctg
gacacacgcccggtcccgccgcgccccgggacccggtctccaggacctcgccgccgccgcccccggccgcccccgccgcc
gccgccacggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggggacgacttctcccg
ccgctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacgg
tggtggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtg
gagagcgtcaaccgggagatgtcgcccctggtggacaacatcgcgctgtggatgaccgagtacctgaaccggcacctgca
cacctggatccaggataacggaggctgggatgcctttgtggaactgtatggccccagcatgcggcctctgtttgatttct
cctggctgtctctgaagactctgctcagcttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaag
tga
>gnl|bcl2dbcds|A0A2K5EBP4_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L1 (length=441 residues).
atgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatgctccacat
cacccccgggacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatggggtaaactggggtcgcattg
tggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
gcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaact
ctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtgg
ccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|A0A2K5EBP4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcactgagggaggcgggcgacgaatttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|A0A2K5EPY9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=399 residues).
agccagagttataataacttaaagataaccacatgcatgcttcgaaaactggacatcaaaaacaaagacgatgtcaaatc
tttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggtaggatcgtgactctcatttcttttggtg
cctttgtggccaaacacttgaagaccataaaccaagaaagctgcattgaaccattagcagaaagtattacagacgttctc
gtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctaga
aggtggcatcagaaatgtgctgctggcttttgcatgtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K5EPY9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=405 residues).
aatgcctcatgttccagacctgcatgcttttcttccccaggcatgcttcgaaaactggacatcaaaaacaaagacgatgt
caaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggtaggatcgtgactctcatttctt
ttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgcattgaaccattagcagaaagtattacagac
gttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcatgtgttgctggagtaggagctggtttggcatatctaataa
gatag
>gnl|bcl2dbcds|A0A2K5F974_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L10 (length=642 residues).
atggctgacccgctgcggcagcgcaccgagcggctggtggcggactacctggagtactgctcccaggagcctggcacccc
cgagtcgccgccgtccacggccgaggccgctgtgctgcgcgccatggccgccggtgtacggaaactctaccggtccttct
tctccgcctacctcggctacccggggaaccgcgtcgagctggtggcgaggatggcggaggccctgctctccgacagtccc
ggccccacctggggcaacgtggtgatgctcctggccttcgcggggacgctgctagagagggggccgctggtgaccgcccg
gtggaagaagtggggcttccagtcgcggctgaaggagccggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcggctcgtggggcagcaccgtgcctggctggaggctcagggcggctgggtgagcatgcggagggggaca
cgggcctcccgagtagctgggaatataggatggcttttgttacttcttcaggacctcctcctcgctggcattatggagaa
aactgctggtccaggttttcctgtcatggttgttaacagcagcattcatctacttctggacacgataattaggagttttt
aa
>gnl|bcl2dbcds|E2IV75_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Aotus vociferans GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcactgagggaggcgggcgacgaatttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|W5LC19_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Astyanax mexicanus GN=BCL2L1 (length=717 residues).
atgtcgtactataaccgagaattagtggtgtactttattaagtacaaactctcacagaggaactatcctactaatcacat
cggactcgtggaagaaacaaatcgaactgaagggggccaggaagcggaggggaacgcagaggcggccgcggtgactccca
ccgcagtcgttaacgggtccgtaaatgggacgagtcacggtgcggcagggtcgcccacctcgtccccccagagaagggcc
aacggggctcgggggctggatgcagtgaaagaggcactgcgggactcagccaacgagtttgagctgcgatactctcgcgc
cttcagcgacctgtcctcccagctgcacatcacgcctgctactgcgtaccagagctttgagagcgtgatggacgaggtgt
ttcgcgatggcgtcaactggggccgcgtcgtaggtttgttcgctttcggcggggctctgtgtgtggagtgcgtggagaag
gagatgagccccctggtgggacgcatcgcagagtggatgaccgtctacttggacaaccacatccagccctggatccagga
gcaaggaggatgggaacgctttgcagagatctttgggaacgacacagcagcagagagcagaaggatgcaggaacgctata
agatgtggctgctggtggggatgaccctgttcacaggaattgtggtgggctctctcatcgctcagaagcgtctgtaa
>gnl|bcl2dbcds|W5LHQ4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Astyanax mexicanus GN=MCL-1 (length=594 residues).
gacgacggctcagtgcccagctcccccttgtcggactgcggggagatggccgttgggaactgcaagcagtacgaaacgct
ggacggagacacgcgagagattatcagtgactttctgaggaacttttgcggactctctcggtcctgtggaggacacggtg
cggttgtacagacaatgaagcgggtggtggacgatctggtggtcaaacatgggattgcgtacaaaggtatgttgaacaaa
ctgggtatggaagacagaggagatgacatgtatgtaattagggcagtagctaaggagctattcagtgatggcatcaccaa
ctggggcagggtcgccagcctggtggcctttggagcagtggtgtccaagcatcagcatgacatgggccgaggccactgtg
tgagtctagtgggtgaagaactatcctcatatcttctgtcagacgaaagggactggctcctaaaaaacaaagcatgggat
ggctttgtggagttttttcgtgttcctgatcctgagtcaacgatgagaaatgcattaatggcctttgttactgtggcagg
tcttggagcctcaatagcatttttggcaagataa
>gnl|bcl2dbcds|A5PJR2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bos taurus GN=MCL-1 (length=1053 residues).
atgttcggcctcaagagaaacgcagtaatcggactaaacctctattgtgggggagccggattaggacagggcagcggcgc
ctcctctccgggggggcggcttttggctgcggggaaggaggccacggcgcggcgagaggtagggggaggggaagccggca
cggtgattggcggaagcgccggcccgagccccccggccactcttgcgcccgacgcccggagggtcgcgcggccctcgccc
attggcgccgagggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccacacgcctcgcgtcgccgcc
tgaagagatggaatccccgatctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
ggaagcggcctgccgtccggcctttacctttgttggtcggagaagccagtaacaacagtccaggctcggacggctcgctg
ccctcgacgccgcccccagcagaggaggaggaggacgagttatatcggcagtccctggagataatctctcagtacctccg
ggagcaggcaaccggcgccaaggacgcgaagcccctgggcgggtctgggaccacaagccggaaggcgttggagaccctgc
gccgagtcggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaatgaa
gacgatgtcaaatctttgtctcgagtgatggttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccactagcagaaagca
tcacagatgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|E1B9B3_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Bos taurus GN=BCL2L10 (length=633 residues).
ggagccatggtggacccgtttagggagcgcaccgcccggctgctgatggactacctggagttctgcgcccgggagccggg
cactccagctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggccgcacgtatccaggaagcaaatcgaa
acgtcttgcccctataccgccgctgccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctactcgacgaa
gaccctggccccagctggggccgcgtggcctcactcgtaaccttcgcggggtcgctgctggagaggccaccgcagacgac
ccgacggcaggagaagagagacgacgacggcgttagcagggactgtcggctcctggtggcccttctgtgtgctcagttct
gcgaaaggcaccgcgcctggctgatgactaacggcggctgggatggattttgtctcttcttcagccactcattccagcca
tcttgggaaagacagctggtctggtttttcctctcatactggacagcaataatcataatctacttctggataaaattatc
agccaacatggacccagccaagcttgtcagcagccaggggaataacatctgtgtggataaaaagccagcctag
>gnl|bcl2dbcds|F1MQX4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bos taurus GN=MCL-1 (length=753 residues).
tgtcaacctcccccaccaactgaagagatggaatccctgatctccgatgccatcatgtcgcccgaagaggagccggacgg
gtgcaagccagaccctctcgggaagcggcctgccgtccggcctttacctttgttggtcagagaagccagtaacaacagtc
caggctcggacggctcgctgccctcgacgccgcccccagcagaggaggaggaggacaagttatattggcagtccctggag
attatctctcggtacctccgggagcaggcaaccggcgccaaggatgtgaagcccctgggcgggtctggggccaccagccg
gaaggcgttggagaccctgcaccgagtcggggatggggtgcagcacaaccacgagacggctttccaaggcgtgcttcaga
aactggacatcaaaaacgaagacgatgttaaatctttgtctcgagtgatggttcatgttttcagtgacagagtaacaaac
tggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacactttaagagtataaatcaagaaagctgcat
cgaaccactagcagaaagcatcacagatgttctcgtaaggtcaaaacgagactggatagtcaaagaaagaggctgggatg
ggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccgga
gtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|F1MV39_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Bos taurus GN=BCL2L10 (length=555 residues).
ggagccatggtggacccgtttagggagcgcaccgcccggctgctgatggactacctggagttctgcgcccgggagccggg
cactccagctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggccgcacgtatccaggaagcaaatcgaa
atgtcttgcccctataccgccgctgccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctactcgacgaa
gaccctggccccagctggggccgcgtggcctcactcgtgaccttcgcggggtcgctgctggagaggccgccgcagactac
ccgacggcagaagagagacgacgacggcgttagcagggactgtcggctcctggtggcccttctgtgtgctcagttctgcg
aaaggcaccgcgcctggctgatggctaacggcggctgggatggattttgtctctttttcagccagtcattccagccatct
tgggaaagacagctggtctggtttttcctcgcatactggacagcaataatcataatctacttctggataaaatta
>gnl|bcl2dbcds|F6R2C4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Bos taurus GN=BCL-2 (length=690 residues).
atggcgcacgcggggggaacaggctacgataaccgagagatcgtgatgaagtacatccactataagctgtcgcagcgggg
ctacgagtgggatgccggagacgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcctcccagccgg
gccgcacacccgcgccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgccg
cctgtggtgcacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
tcagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacacctggatccaggacaacggaggctgggacgc
ctttgtggagctgtatggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctgg
ccctggtgggcgcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|O02718_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Bos taurus GN=BCL-2 (length=687 residues).
atggcgcacgcggggggaacaggctacgataaccgagagatcgtgatgaagtacatccactataagctgtcgcagcgggg
ctacgagtgggatgccggagacgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcctcccagccgg
gccgcacacccgccccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgccg
cctgtggtgcacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
tcagctgcacctgacgcccttcaccgcgagggaacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacacctggatccaggacaacggaggctgggacgc
ctttgtggagctgtatggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctgg
ccctggtgggcgcttgcatcaccctgggtgcctatctgggccataag
>gnl|bcl2dbcds|Q05KI8_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Bos taurus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggtcggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcttcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|Q05KJ0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bos taurus GN=BCL2L1 (length=702 residues).
atgtctcagagtaaccgggagctggtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggacagaatcagatatggaaacccccagtgccatcaatggca
acgcatcctggcacctggcggatagccctgctgtgaatggagccactggccacagcagaagctcggatgcccgggaagtg
atccccatggcagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacgtcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|Q1RMX3_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Bos taurus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcttcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|Q3C2I0_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Bos taurus GN=BCL2A1 (length=528 residues).
atgactgacactgagtttggctacgttcacgggctggctgaggactatctgaaatatgtgttgcagatacagcaacctgg
atccaagccaagcaaaacatccagggtgttacaagatgtggcttcctctgtccaggacgaagtggaaaggactctgaagc
agtgcttggataagtttgatgtggtgtccgtagacactgccagaacaatattcaaccaagtgatggaaaaggaatttgaa
gatggcattgttaactggggcaggattgtaaccatattcgcctttgaaggtattcttaccaagaaacttctgggcaagtg
tattgcctcagacatggacatgtgcaaggacatttctttctttgtggcggagttcatcaccgaaaatacaggagagtgga
taaagcaaaatggaggctgggaaaatgggtttgtaaagaagtttgaaaccaaatctggctggctgacttttctggaagtt
acaggaaagatctgtgaaacattatgtcgcctgaagcaatactattga
>gnl|bcl2dbcds|J7H260_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bufo japonicus formosus GN=MCL-1 (length=639 residues).
atgggcggctctctgccctccccgcagtccgagctggacgaggacgaggattacatggacgtacagtcggactcccgggg
ctccacctcccctccgctcacccccacctgctccccggaccccctgcacacggaaacccgcgccctgctgcacaccttct
tcagggaatgggccggagacgcgaagcaggaggacggcgacagcccgaaggcgctgcccaccatgcgcaggctggggggc
gacatcaatgagaagcaccgaatggcctttcagggcatgttgcagaagttatctatacaacgtccagaagatatccagaa
gctctccgaggtcccctctatggtcttcagcgatggggttaccaattggggccgtatcgtcaccgtgataagctttggtg
cgtttgtggctaaacatttgaaaagcatccacatggagaactgcgttggaatcctagcggacagcttcacagactatctt
atgacccagaagaaagaatggatcgtagaacacaatggctgggatggctgtgtcgaattctttcacgtcgaggactatga
gagtggactaaaaacagtcttgatggccttcgctggtgtggctggtcttggagcaagcctggcgtacatgatccggtga
>gnl|bcl2dbcds|A0A2R8M4C0_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L2 (length=645 residues).
cttctggttctctgtccatatattaatgccagtctttcatccttgcctcttatagctgcccggatggcgaccccagcctc
cgccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaaaggttatgtctgtggaactggcc
ccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagctggagatgaattcgagacccgcttccggcgc
accttctctgatctggcggctcagctgcatgtgaccccaggttcagcccaacaacgcttcacccaggtctccgatgaact
tttccaagggggtcccaactggggccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtgtcaaca
aggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggctggccgactggatccac
agcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcggcgtctgcgggaggggaa
ctgggcatcagtgaggacagtgctgacaggggccgtggcactgggggccctggtaactgtaggggccttttttgctagca
agtga
>gnl|bcl2dbcds|A0A2R8M4C0_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L2 (length=1041 residues).
atggcgaccccagcctccgccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaaaggtta
tgtctgtggaactggccccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagctggagatgaattcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggttcagcccaacaacgcttcacc
caggtctccgatgaacttttccaagggggtcccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggccgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggaactacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
gcagatcaagattgactttaaggctttcatttattcatctctgactcaggtgatcccaaaacgaaccaacagaccaggca
tcagcacaacagaccggggttttccacgagcccgctaccgcgcacggaccaccaactacaacagttcccgctctcgattc
tacagtggttttaacagcaggccccggggtcgcgtctacaggggccgggctagagcgacatcatggtattccccttacta
a
>gnl|bcl2dbcds|A0A2R8MY14_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Callithrix jacchus GN=BCL-2 (length=723 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagatgtgggcgccgcgcccccaggggccgcccccgcggagggcatcttctcttcccagcccg
ggcacacgcccggtcccgccgcgccccgggacccggtcgccaggacctcgccgccgccgcccccagccgcccccgccgcc
gccgccacggggcctacgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccg
ccgctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacgg
tggtggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtg
gagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgaccgagtacctgaaccggcacctgca
cacctggatccaggataacggaggctgggatgcctttgtggaactgtatggccccagcatgcggcctctgtttgatttct
cctggctgtctctgaagactctgctcagcttggtcctggtgggagcttgcatcaccctgggtgcctatctgggccacaag
tga
>gnl|bcl2dbcds|F7CT87_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L10 (length=681 residues).
atggctgacccgctgcggcagcgcaccgagcagctggtgacggactacctggagtactgctcccgggagcctggcacccc
cgagtcgccgccgtccaccgccgaggccgctgtgctgcgcgccgtggccgccagtgtgcggaaactctaccggtctttct
tctccgcctacctcggctaccccgggaaccgcgtcgagctggtggcgaggatggcggaggccctgctctccgacagtccc
ggccccacctggggcaacgtggtgatgctcctggccttcgcggggacgctgctagagagggggccgctggtgaccgcccg
gtggaagaagtggggcttccagtctcggctgaaggagccggaaggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagttcgcggctcgtggggcagcaccgtgcctggctggaggctcagggcggctgggtgagcaaggagggggacacg
gggcgggataggcacctgggaaccgcccgcccacgatggcttttgttacttcttcaggacctcctccttgctggcattat
ggagaaaagtgctggtccaggttttcctgtcatggttgttaacagcagtattcatctacttctggacacgataatgagga
gttttaaaagttttagcccacttctacctgcccaactgtga
>gnl|bcl2dbcds|F7GTF7_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Callithrix jacchus GN=MCL-1 (length=594 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagca
ggaaggcgctggagaccttacgacgggttggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggtaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgca
ttgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcgggtgttgctgg
agtaggagctgggttggcatatctaataagatag
>gnl|bcl2dbcds|F7GTF7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Callithrix jacchus GN=MCL-1 (length=813 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccacagagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgcggtgactggcggaagcgccggcgctagccccccggccgccctcacgcctgacgcccgaagggtcgtgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgcc
gctggaggagatggaagccccggccgccgacgccatcatgtcgccggaagaagagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctctgctggagttggtcggggagcctgctaatggctccagtacggacgggtcacta
ccgtcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagcaggaaggcgctggagaccttac
gacgggttggggacggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcgggtgttgctggagtaggagctgggttggcatatctaataa
gatagccttggaa
>gnl|bcl2dbcds|F7GTF7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Callithrix jacchus GN=MCL-1 (length=1053 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccacagagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgcggtgactggcggaagcgccggcgctagccccccggccgccctcacgcctgacgcccgaagggtcgtgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgcc
gctggaggagatggaagccccggccgccgacgccatcatgtcgccggaagaagagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctctgctggagttggtcggggagcctgctaatggctccagtacggacgggtcacta
ccgtcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagcaggaaggcgctggagaccttac
gacgggttggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggtaggattgtgactct
catttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgcattgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcgggtgttgctggagtaggagctgggttggcata
tctaataagatag
>gnl|bcl2dbcds|F7IT34_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagcccagtggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcactgagggaggcaggcgacgagtttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|F7IT34_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L1 (length=444 residues).
atgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggcaaccca
tcctggcacctggcggacagcccagtgctttgaacaggtagtgaacgaactcttccgggatggggtaaactggggtcgca
ttgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
gcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtgga
actctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactg
tggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|F7IT34_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagcccagtggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcactgagggaggcaggcgacgagtttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|U3DBA0_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2A1 (length=528 residues).
atgacagactctgaatttggatatattcacaatctaactcaggactatctgcagtacgtcctgcagataccacagtctgg
aatgggtccgagcaaaacgtctagagtgctacaacaggttgcattctcagtccaaaaagaagtggaaaagagtctgaagt
catgcttggacaatgttgatattgcgtccatagataatgccagaacgatattcagtcaagtgatggaaaaggaatttgaa
gatggcattattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgagagcg
aattgccccggatgtggatacttacaaggagatctcacattttgttgctgagttcataatgaataacacaggagaatgga
taagacaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgcgaaatgctatctctcttgaagcaatactgttga
>gnl|bcl2dbcds|U3DBA0_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2A1 (length=489 residues).
atgacagactctgaatttggatatattcacaatctaactcaggactatctgcagtacgtcctgcagataccacagtctgg
aatgggtccgagcaaaacgtctagagtgctacaacaggttgcattctcagtccaaaaagaagtggaaaagagtctgaagt
catgcttggacaatgttgatattgcgtccatagataatgccagaacgatattcagtcaagtgatggaaaaggaatttgaa
gatggcattattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgagagcg
aattgccccggatgtggatacttacaaggagatctcacattttgttgctgagttcataatgaataacacaggagaatgga
taagacaaaacggaggctgggggaaatggcacagtctcatgcttatgctagtatcagtggcccagaagaagaggaaaatg
gctttgtaa
>gnl|bcl2dbcds|E2RS00_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2A1 (length=525 residues).
atgacggactgcgagtttggctacacgctggcgctggcccaggactacgtgaggcacgtcctgcagatcccgcagcccgg
cccggcccccagcagagcgtccagggtgctccaggacgtggccttctccgtccaggggcaggtggaaaagaacctgaagc
cgtgcttggacagttttgacgtggtgtctgtcgacacggccagaaccatattcaatcaggtgatggagaaggaatttgaa
gacggcgtcattaactggggaaggatcgtgaccgtttttgcctttgaaggaattctcaccaagaaactcctcgagcagcg
aatttcctcggatgtggatgccgagaaggtttcctacttcgtggcagagttcatcacgagaaacatgagagactggataa
gacaaaacggaggctgggaaaacggctttgtgaagaagttcgaacccaagtctggatggctgacttttctggaagttctg
ggaacagtgtgtgaaatgtggtcacacctaaagcaatactactga
>gnl|bcl2dbcds|J9NXG3_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=480 residues).
atggcgcacgctgggcgaacagggtacgataaccgggagatagtgatgaagtacatccactacaagctgtcgcagagggg
ctacgagtgggacgcgggagaggcgggcgccgcgcccccgggggccgcccccgcgccgggcatctccgcctcgcncagcc
ccgtgccacctgtggtccacctgaccctgcgccaggccggcgacgacttctcccgccgctaccggcgtttcgccgagatg
tccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttcagggatggggt
gaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccc
tggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggatccaggacaacggaggctgg
>gnl|bcl2dbcds|J9NXG3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=654 residues).
atgaagtacatccactacaagctgtcgcagaggggctacgagtgggacgcgggagaggcgggcgccgcgcccccgggggc
cgcccccgcgccgggcatctccgcctcgcagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncagccccgtgccacctgtggtccacctgaccctgcgccaggccggc
gacgacttctcccgccgctaccggcgtttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacg
ctttgccacggtggtggaggagctcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtgggg
tcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaac
cggcatctgcacacctggatccaggacaacggaggctgggatgcctttgtggaactgtacggccccaccatgcagcctct
gtttgacttctcctggctgtctctgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatc
tgggccataagtga
>gnl|bcl2dbcds|J9PBC4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Canis lupus familiaris GN=MCL-1 (length=1404 residues).
atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgggggggccgggctgggggccggcagcggcgg
cgcctcctcttcgggagggcggcttttggcttcggggaaggaggccacgaccagacgggagggagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcgcgcggccctca
cccattggcgctgagggccccaacgtcagcgcgacccccccgaggctgctgctgctcgcgcccccctgccgcgcgtcgcc
gcctgaagagatggaaggcccggccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccggaacctt
tggggaagcggccggcggtcctgcctctgctggagttggtgggggaggccagcagtggccccggcatggacggctcgcta
ccctcgacgccacccccggcggaggaggaggaagatgagttgtaccggcagtccctggagattatctctcggtaccttcg
ggaacaggccacaggcgccaaggacgcgaaaccactgggcgggtctcgggcggccagccggaaggcgttagagaccctcc
ggcgagtcggggacggggtacagcgcaaccacgagacagccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatcgttgtctcgagtgattgtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcctttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggatggaggggtgtggggggagtgg
tccaccccctctgaccttaagggtgagagcaggaaggaatgctgcccttcctgggccgctgaggctggaaggtggggggc
tgacctcagcctccagaccgtggctcagtggctcagtcccctcctgtcagcctgcaggaactcctcagctcctccctcct
ccccactagggattgtttacaggacagcttgggccacacagcacacgctcttcctgaagatgattctgatctggtttgcc
ctcctccctcccagaggaccccgatggccgagggaggcatgggtgacaacatgtgggacacccactccaaggagtggacc
agaagccccatgggagttcctttccctacctgccacccagctctttctcccatttttaacgaagctccttctggaacact
caggcatctctgccggactcaaacactttgtagccaagagataa
>gnl|bcl2dbcds|J9PBC4_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Canis lupus familiaris GN=MCL-1 (length=1053 residues).
atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgggggggccgggctgggggccggcagcggcgg
cgcctcctcttcgggagggcggcttttggcttcggggaaggaggccacgaccagacgggagggagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcgcgcggccctca
cccattggcgctgagggccccaacgtcagcgcgacccccccgaggctgctgctgctcgcgcccccctgccgcgcgtcgcc
gcctgaagagatggaaggcccggccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccggaacctt
tggggaagcggccggcggtcctgcctctgctggagttggtgggggaggccagcagtggccccggcatggacggctcgcta
ccctcgacgccacccccggcggaggaggaggaagatgagttgtaccggcagtccctggagattatctctcggtaccttcg
ggaacaggccacaggcgccaaggacgcgaaaccactgggcgggtctcgggcggccagccggaaggcgttagagaccctcc
ggcgagtcggggacggggtacagcgcaaccacgagacagccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatcgttgtctcgagtgattgtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcctttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|Q45T69_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggtta
tgtttgtggagctggccctggagagggcccagcagctgatccactgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccagcaacgcttcacc
caggtctctgacgaactcttccaagggggccccaactggggccgtcttgtggccttctttgtctttggagctgcactgtg
tgctgagagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
tggccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacgggggccgtggcactgggggccctggtcaccgtagg
ggccttttttgcgagcaagtga
>gnl|bcl2dbcds|Q6R755_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=711 residues).
atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatacattataagctgtcacagagggg
ctacgagtgggatgtgggagatgtggacgccgcgcccctgggcgccgcccccacccctggcatcttctccttccagcctg
agagcaacccaacgcccgctgtgcaccgggacatggctgccaggacatcgccactaaggcccatagtcgccaccactggg
cctacccttagccccgtgccacctgtggtccacctgaccctccgccgggctggggatgacttctcccgtcgctaccgtcg
cgacttcgcggagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagc
tcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
cgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggacaacggaggctgggatgcctttgtggaactgtacggccccaccatgcagcctctgtttgatttctcctggctgtctc
tgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|Q75SV7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=720 residues).
atggcgcacgctgggcgaacagggtacgataaccgggagatagtgatgaagtacatccactacaagctgtcgcagagggg
ctacgagtgggacgcgggagaggcgggcgccgcgcccccgggggccgcccccgcgccgggcatcttctcctcgcagcccg
gccgcgcccccgcgcccgccaggacctcgccgcccccgccccccgccgcccccgctgccgccgccgccgccgccgccgac
gccgcgggccccgcgcccagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtgg
tggaggagctcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacac
ctggatccaggacaacggaggctgggatgcctttgtggaactgtacggccccaccatgcagcctctgtttgacttctcct
ggctgtctctgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|Q76LT7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcagacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaaacaagcgctgagggaggctggggatgagtttgaactgaggtaccggcgggcattcagtga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|Q8HYS5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Canis lupus familiaris GN=MCL-1 (length=1053 residues).
atgtttggcctcaagagaaacgcagtaatccggactcaactctactgtgggggggccgggctgggggccggcagcggcgg
cgcctcctcttcgggagggcggcttttggcttcggggagggaggccacgaccagacgggagggagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcgcgcggccctca
cccattggcgctgagggccccaacgtcagcgcgacccccccgaggctgctgctgctcgcgcccccctgccgcgcgtcgcc
gcctgaagagatggaaggcccggccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccggaacctt
tggggaagcggccggcggtcctgcctctgctggagctggtgggggaggccagcagtggccccggcatggacggctcgcta
ccctcgacgccacccccggcggaggaggaggaagatgagttgtaccggcagtccctggagattatctctcggtaccttcg
ggaacaggccacaggcgccaaggacgcgaaaccactgggcgggtctcgggcggccagccggaaggcgttagagaccctcc
agcgagtcggggacggggtacagcgcaaccacgagacagccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatcgttgtctcgagtgattgtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcctttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A076FU27_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Capra hircus GN=BCL-2 (length=690 residues).
atggcgcacgcggggggcacaggctacgataaccgcgagatcgtgatgaagtacatccactacaagctgtcgcagcgcgg
ctacgagtgggatgccagagccgcgggcgccgcgccccccggggccgcccccgcgccgggcatcctgtcctcccagccgg
gccgcacacccgcgccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgcca
cctgtggtccacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
ccagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatatgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacgcctggatccaggacaacggaggctgggacgc
ctttgtggagctgtacggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctgg
ccctggtgggcgcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A076FZV9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Capra hircus GN=BCL-2 (length=690 residues).
atggcgcacgcggggggcacaggctacgataaccgcgagatcgtgatgaagtacatccactacaagctgtcgcagcgcgg
ctacgagtgggatgccggagccgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcctcccagccgg
gccgcacacccgcgccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgcca
cctgtggtccacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
ccagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacgcctggatccaggacaacggaggctgggacgc
ctttgtggagctgtacggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctgg
ccctggtgggcgcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A1L5BWY3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Castor fiber GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaataggactgaggccccagaagggattgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatgacagcagtgaagcaagcgctgagggaggcaggtgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacataaccccggggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggctacttacctgaatgaccacctagaaccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcagcagctgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A286XQQ9_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Cavia porcellus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggctgactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggccctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggggatgagttcg
agacccgattccggcgcaccttctctgatctggctgctcagctgcatgtgacccctggctcagcccagcaacgcttcacc
caggtctccgacgaacttttccaaggtggccccaactggggccgtcttgtggccttctttgtctttggcgctgccctgtg
tgctgagagtgtcaacaaagagatgcaaccactggtgggccaagtgcaggagtggatggtggcctacctggagacgcgcc
tggccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacaggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A286XUI2_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Cavia porcellus GN=BCL2A1 (length=609 residues).
atgggtcacatcctgctcagcgccactgctggcagtctcgatctgcgcgagccagcagcaggctgctgtctgccgcccag
gatgattgacctggagttcaggtacacgcaggctctggcccaggactacctgctccacgtcctgcaggtgcctcagtgcg
agaccagccccagcaaggcatccaaggtgctgcaggacatggccctttccgtccaggaagaggtggagaggcggctgaaa
ccgtggctggacagaattgacgtggagtccatcgacactgcgaagtcgatattcaaccaagtgatggagaaggagttcga
ggatggcatcattaactggggacggattgtgactatctttgcttttgggggggtcatcctcaagaaactcccacgagagc
caatcgccccagatgtggacacttacaaggagatttcctacttcgtggctgagttcataatgagccgcatgggaggctgg
atacggcagaacggaggctgggacaacggcttcgtgcggaagtttgagcccaaatctggctggctgacttttgtgggagt
tatgggacagctctgtgagatgctctctctcctgaagcaattctactga
>gnl|bcl2dbcds|A0A286Y1M5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cavia porcellus GN=MCL-1 (length=702 residues).
atgtcgcctgaggaggagctggacgggtacgagccggagcccctcgggaagcggccggccgtgctgcccttgctggggct
ggtgggggaggccgggaagagccccagcgccgacggttcgctgccctcgacgccgcccccggcggaggaggaggaggagg
aggacgcgctgtaccgacagtcgctggagatcatctcgcggtacctgcgggagcaggccgcgggcgccaaggactcgaag
ccgctgggcggggtggggcccaccagcaggaaggcactggagaccctgcggcgggtcggggacggcgtgcagcgcaacca
ccagaccgccttccaaggaatgcttcggaaactggacatcaaaaacgaagacgatgtcaaatccttgtcgcgagtggttg
cccttgttttcagtgacggcgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggccaaacac
ttgaagagcataaaccaagaaagctgcatcgaaccattagcggaaagtatcacagatgctctggtgcactcaaaaaggga
ctggctagtcaaacaaagaggctgggatgggtttgtggagttcttccatatagaggatctagaaggcggcatcagaaatg
tgctgctggcttttgcaggtgttgctggagtaggggctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A286Y5D6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cavia porcellus GN=BCL2L1 (length=702 residues).
atgtctcaaagcaactgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaaggcccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacctaactgatagtcccacggtgaatggggccactggccacagcagtagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagctcttagggaggcgggcgatgagtttgaacttcggtaccggcgagcattcagcga
cttaacatctcagctccacatcaccccggggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcattgtgcgtggagagcgtagacaaggagatgcag
gtattggtgaggcggatcgcaagctggatggctacttacctgaatgaccacctagaaccttggatccaggacaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tgctgacgggcgtgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|H0W1T3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cavia porcellus GN=BCL-2 (length=549 residues).
atggctcacgctgggagaacagggtatgataaccgggaaatagtgatgaagtacatccactataagctgtcccagagagg
ctacgagtgggatgccggagacgggagcgcactgggtcgcaactccccgcttggtgtgccccgggacccggccgccagga
cctcgccaccgccacccctggccggcctcgccgtcgcccaggggcctgcgctcagcccggtgccacctgtggtccacctg
accctccgccaggccggcgatgacttctcccgccgctatcgccaagacttcgctgagatgtccagccagctgcacctgac
gcctttcaccgcgaggggacgctttgccacgctcttcagggatggggtgaactgggggaggattgtggccttctttgagt
tcggtggggtcatgtgtgtggagagtgtcaaccgggagatgtcacctctggtggacaacatcgccctctggatgactgag
tacctgaaccggcacctgcacacctggatccaggataacggaggatgggtaggtgcatgtttgagtgag
>gnl|bcl2dbcds|A0A2K5KHH9_BCL2A1-03 BCL2-related protein A1 gene OS=[Eukaryota] Cercocebus atys GN=BCL2A1 (length=492 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtacgttctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggaatttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggggaaatggcacaatcacatgcctatgctagtagagtcagtggcccacaggaagaagaaa
atggctttgtaa
>gnl|bcl2dbcds|A0A2K5KHH9_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Cercocebus atys GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtacgttctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggaatttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagcttgagcctaaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctctctcttctgaagcaatactgttga
>gnl|bcl2dbcds|A0A2K5KHH9_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Cercocebus atys GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtacgttctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggaatttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctatctctcctgaagcaatactgttga
>gnl|bcl2dbcds|A0A2K5LXU8_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cercocebus atys GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatccttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggctgttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K5LXU8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cercocebus atys GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatccttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggctgttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2K5LXU8_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cercocebus atys GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggctgttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2K5M8B1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cercocebus atys GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5M8B1_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Cercocebus atys GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtgaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5MMZ4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Cercocebus atys GN=BCL2L10 (length=585 residues).
atggctgacccgttgcgggagcgcaccgagcggctcctggccgactatctggggtgctgcgcccgggaacccggcacccc
tgagccgaggccgtccacgcccgaggccgccgtgctgcgctcagcagccgccaggttacggcagctccaccggtccttct
tctccgcctaccgcggctaccgcgggaaccgcgtcgagctggtggcgctgatggcggaggccgtgctctccgacagcccc
ggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgctggtgacagcctg
gtggaagaagcggggcttccagccgcggctgaaggagcaggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcagggcggctgggatggcttttgtcacttcttc
aggagcccctttccgctggctttttggagaacactgctgatccaggctttcctggcatgcttgttagcaacagccttcgg
ttatctctggacacgattattatga
>gnl|bcl2dbcds|A0A2K5MZX9_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Cercocebus atys GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
ggatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
gcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctacc
gcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A2K5MZX9_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Cercocebus atys GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A2K5NZS5_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cercocebus atys GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggcgcggcgacccctggggtcgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggacgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A0D6DR75_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Channa striata GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtggtttactacataacatataaactgtcggagaaaaactatcctctcaaccacttggg
actcagtgagcctccaaacaggactgatggaggggaggttgagtccgctgaggaacagcggatagcgacgcacgccaacg
gtacttttaacggaagaagtcctggaacccccccagcatccccgctcaggcaacaacggttgccatcaccgacgagcctg
gatgcggtgaaagaggccctccgggactcagccaatgagtttgagctgcgatatgcccgcgccttcagcgatctgcacaa
ccagctgcatatcacgcccgccacggcctaccaaagctttgcgaacgtcatggatgaagtgttccgggacggcgtcaact
ggggccgcatcatagggctctttgcatttggtggggcactgtgtgttgagtgtgtggagaaggagatgagtcagctggtg
gtcaggatcgtagagtggatgacagtgtacctggacgaccacattcagccctggatccaaagtcaaggaggatgggagca
ctttgctgaaatcttcgggcatgatgcagctgcagagagcaggaggtctcaggagagtttcaagaagtggctgctggcgg
ggatgacggtggtgacgggcgttgtggctggtgctcttatcgcgcaaaaacgcctgtga
>gnl|bcl2dbcds|A0A0D9RG38_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Chlorocebus sabaeus GN=BCL2L10 (length=582 residues).
atggctgacccgttgcgggagcgcaccgagcggctcctggccgactatctggggtgctgcgcccgggaacccggcacccc
tgagcccaggccgtccacgcccgaggccgccgtgctgcgctccgcggccgccaggttacggcagctccaccggtccttct
tctccgcctacctcggctaccccgggaaccgcgtcgagctggtggcgctgatggcggacgccgtgctctccgacagcccc
ggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgctgatgacagcctg
gtggaagaagcagagcttccagccgcggctggagcaggagggcgacgtcgcccgggactgccagcgcctggtggccttgc
tgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcaaggcggctgggatggcttttgtcacttcttcagg
agcccctttccgctggctttttggagaaaactgctgatccaggctttcctggcatgcttgttagcaacagccttcggtta
tctctggacaagattattatga
>gnl|bcl2dbcds|A0A0D9RJZ8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Chlorocebus sabaeus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaaacgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A0D9RRC3_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Chlorocebus sabaeus GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtacgtcctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcatcctcagtccaaaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataacgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctatctctcctgaagcaatactgttga
>gnl|bcl2dbcds|A0A0D9RU30_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Chlorocebus sabaeus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcgcagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A0D9RZP5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Chlorocebus sabaeus GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggctcggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgctggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagctccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgagcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A0D9S017_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Chlorocebus sabaeus GN=BCL-2 (length=717 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggcgccgcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggacgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaag
>gnl|bcl2dbcds|A0A059PJI5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Clarias batrachus GN=BCL2L1 (length=717 residues).
atgtcttactacaacagagaacttgtcgtgtacttcatcaagtacaagctctcccagaaaaactacccctgcgaccacat
cggcctcacggaagaggtgaacggccaggtggcggaagagaacgcggtgggagcgggagagtcggagacgccgacagcag
tcgttaatggcaccctaaacgggaccggatcggcaggcactccaccgcgatcgccgactttgtcccctcagaggcaggtg
aatggcagcgcaagcctggaggcagtaaaggaggcgctacgtgactctggcaatgagttcgagctgcgctattcacgcgc
ctttagcgacctgtcatcacagttgcatataactccagtcacggtgtaccagagctttgagagcgtgatggacgaggtgt
tccgcgacggcgtcaactggggccgtatcgtgggcttgttcgcttttggaggtgccctctgtgtcgagtgtgtggaaaag
gagatgagtccgctggtggcacgtatcgccgagtggatgaccgtctacctggacaaccacatccagccctggattgaaga
gcaaggaggatgggaacggtttgcagagatctttgggaaagatgcagcagcagaaggcagaaggtcacaggaaagcttta
agaagtggctgctggcaggtgtgacactcttcacgggggtggtggtgggctccttcatcgctcagaagcgcctgtaa
>gnl|bcl2dbcds|A0A2K5H963_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctagtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagctgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5H963_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcaact
tggatggccacttatctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
tgggaacaatgcagcagctgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5HEK7_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcgcagcaacgcttcacc
caggtctctgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A2K5HEK7_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcgcagcaacgcttcacc
caggtctctgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
gggtttgcgtatatagagttctcagacaaagagtcagtgaggacgtccttggccttagatgagtccctatttagaggaag
gcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctacc
gcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A2K5HK49_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggagccgcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgcggggcctgcgcttagcccagtgccacctgtggtccaccttaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgtggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A2K5I9Q7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=MCL-1 (length=1050 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctaatagctccagtacggatgggtcactaccc
tcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggaaattatctctcggtaccttcggga
gcaggccactggcgccaaggacacacagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttacgac
gggtgggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaagac
gatgtcaaatctttatctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgactctcat
ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagttgcatcgaaccattagcagaaagtatca
cagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccatgta
gaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatct
aatcagatag
>gnl|bcl2dbcds|A0A2K5I9Q7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=MCL-1 (length=813 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctaatagctccagtacggatgggtcactaccc
tcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggaaattatctctcggtaccttcggga
gcaggccactggcgccaaggacacacagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttacgac
gggtgggggatggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagaggacct
agaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaatcagat
agccttactgtaa
>gnl|bcl2dbcds|A0A2K5I9Q7_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccactggcgccaaggacacacagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggtgggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttatctcgagtgatgatccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagttgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaatcagatag
>gnl|bcl2dbcds|A0A2K5K3B0_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L10 (length=615 residues).
atggctgaccagttgcgggagcgcaccaacgtggctgacccgttgcgcgagcgcaccgagcggctgctggccgactatct
ggggtgctgcgcccgggaacccggcacccccgagccgaggccgtccacgcccgaggccgccgtgctgcgctccgcggcgg
cccgattacggcagctccatcggtccttcttctccgcctacctcggctaccccgggaaccgcgtcgagctggtggcgctg
atggcggaggccgtgctctccgacagccccggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgct
gctggagagagagccgctggtgacagcctggtggaagaagcggagcttccagccgcggctgaaggagcaggagggcgacg
tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcag
ggcggttgggatggcttctgtcacttcttcaggaccccctttccgctggctttttggagaaaactgctgatccaggcttt
cctggcatgcttgttaacaacagccttcggttatctctggacacgattattatga
>gnl|bcl2dbcds|A0A2K5KAB6_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2A1 (length=492 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtacgtcctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccaggaagaagtggaaaagaatctgaagc
cgtgcttggacaatgttaatgttgcatccatagacactgccagaacaatattcaatcaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggggaaatggcacaatcacatgcctatgctagtagagtcagtggcccacaagaagaagaaa
atggctttgtaa
>gnl|bcl2dbcds|A0A2K5KAB6_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtacgtcctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccaggaagaagtggaaaagaatctgaagc
cgtgcttggacaatgttaatgttgcatccatagacactgccagaacaatattcaatcaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctatctctcctgaagcaatactgttga
>gnl|bcl2dbcds|A0A0U3DHY6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Coregonus lavaretus GN=BCL-2 (length=684 residues).
atggcaaacgagaatccttatgacagtcgctttattgtcgaaaaatacatccataacaaactgttgaagaagggatttgt
atgggaatttcaagcagaaaacgattctccaaataatttatttggggacccctctacacccaacacccccgaagtttttg
cacggaggtcccagcccaccgccgcggtcgaggacaccgactctcctttccaaaacaggagtccgcaaccggacccacat
gtcaggctccacagggtcctgcgcgaggcgggggacgagattgaaagaatgtatctgcgggactttgcagagatgtcggg
gcaattgcattttacgcccagcacggcacaganaaggtttaccgctgtaatagatgagctcttcagcgacggggtaaact
ggggtcggattgtggctttctttgagtttggagggacaatgtgcgtggagagcgtcaaccgggagatgacgtcccaggtg
gacaacatcgctctttggatgacggagtacctgaacggacccctacagaactggatccaggagaatggtggctgggacgc
ctttgtggagatctatgaacagcagaggatctctcactcctggccgtacctaaagacagtgttcggcctggccgccctgg
gagccgtcggagtcaccatcggagccttgttcacccagaagtga
>gnl|bcl2dbcds|B2Z3Z4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cricetulus griseus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctagtggttgactttctctcctacaagttctcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaacaggactgaggccccagaaggaactgaatcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtaaatggagccactggccacagcagcagtttggatgcacgggaggtg
atccccatggcagccgtaaagcaagcgctgagagaggccggcgatgagtttgagctgcggtaccggcgggcgttcagtga
tctaacatcccagcttcatataaccccagggactgcatatcaaagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggtggagccctctgtgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggacaacggcgg
ctgggacactttcgtggaactctacggaaacaatgcagcagctgagagccggaaaggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctctctcttcagtcggaagtga
>gnl|bcl2dbcds|Q9JJV8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cricetulus griseus GN=BCL-2 (length=711 residues).
atggctcaagctgggagaacagggtatgataaccgagagatcgtgatgaagtacatccattataagctgtcacagagggg
ctacgagtgggatgtgggagatgtggacgccgcgcccctgggcgccgcccccacccctggcatcttctccttccagcctg
agagcaacccaacgcccgctgtgcaccgggacatggctgccaggacatcgccactaaggcccatagtcgccaccactggg
cctacccttagccccgtgccacctgtggtccacctgaccctccgccgggctggggatgacttctcccgtcgctaccgtcg
cgacttcgcggagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgctacggtggtggaggaac
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcacccctggtggacaacatcgccctgtggatgaccgagtacctgaaccggcatctgcacacctggatcca
ggataacggaggctgggacgcatttgtggaactgtacggccccagtgtgaggcctctgtttgatttctcttggctgtctc
tgaagaccctgctcagcctggccctggtcggggcctgcatcactctgggtacctacctgggccacaagtga
>gnl|bcl2dbcds|Q923R6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cricetulus longicaudatus GN=BCL-2 (length=711 residues).
atggctcaagctgggagaacagggtatgataaccgagagatcgtgatgaagtacatccattataagctgtcacagagggg
ctacgagtgggatgtgggagatgtggacgccgcgcccctgggcgccgcccccacccctggcatcttctccttccagcctg
agagcaacccaacgcccgctgtgcaccgggacatggctgccaggacatcgccactaaggcccatagtcgccaccactggg
cctacccttagccccgtgccacctgtggtccacctgaccctccgccgggctggggatgacttctcccgtcgctaccgtcg
cgacttcgcggagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgctacggtggtggaggaac
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcacccctggtggacaacatcgccctgtggatgaccgagtacctgaaccggcatctgcacacctggatcca
ggataacggaggctgggacgcatttgtggaactgtacggccccagtgtgaggcctctgtttgatttctcttggctgtctc
tgaanaccctgctcaacctggccctggtcggggcctgcatcactctgggtacctacctgggccacaagtga
>gnl|bcl2dbcds|X4ZGI8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyprinus carpio GN=BCL-2 (length=690 residues).
atggccaacgaaattcgctatgacaatcggaatattgtggagaaatacctcaatcacaaactttcaaagaagggatatga
gtggaaatttcaatcttccggggaggatgatgacactatcaatacgggagtggaggactcctctccgagctctgacagga
ggctccaggctccctcagccggagggggaaacaactctgaatgcctgatagcaaaccgggtcacacgttcagacccttat
tcgaggatctaccgatcgttacgcgaggctggagaccagatagaaaggatgtaccagcgtgaatttgaggagatgtccca
ccagatgacattcagtcccagtgcagcacaacgcagcttcttagctgtggctgaagagctcttcagagacggagtgaact
gggggcggatcgtcgctttctttgagtttggtgggaccatgtgtgtggagagcttcaaccgggagatggcgtcccaggta
gataatattgcacactggatgacagactacctgaacgggccactggaaaactggatcgaggaaaatggaggctgggacgc
ctttgtggagttatacagtcagcagagagaccctatgttccacccattgtcgtacctaacgaaagtgcttggattggcag
cactaggcttggcaggagtgaccatcggagcctttttcgctcagaagtga
>gnl|bcl2dbcds|F8W4Q8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=687 residues).
atgttcgctggaagaaacaacgacaacggcttttggccatgcactggattacaaagcaaaccactggttattccagaact
gaaagcgcataaccagtttgcggtggactctctccagggctcggtaccgtcctcgccttcggacgaaacgggggattatc
cccccaccgcccttgacatggacacgcgggagattattgacactttcttaaaaatctttacaggactccctcattctaaa
agtggacgaaaacaagtactgtcaacaatgaggcgggttgtggacaatctcgcggtgaagcacgagctcgcttacaaagg
tatgattgcacggctgaatctggagcagaaaggagaagatgtaagtttcatcaagcaagtggcaacagagctctttagcg
atggcaccacaaactggggtcgtattgccagcctgctgacatttggggcaatgctgtgcaaataccagaatgacagagga
catagcaagtatgtgaggttggtaggggaggagatctcgtcttatctacttacagagcagcgggactggatactcagaaa
caaagcatgggatggctttgtggagttttttcatgtcccggatacagaggcagctgtgagaaacacacttctaacaattg
gtggtgtggctacattaagtgcagcacttgcctattggatacggtga
>gnl|bcl2dbcds|F8W4Q8_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=390 residues).
atgattctctggactctttcaggtatgattgcacggctgaatctggagcagaaaggagaagatgtaagtttcatcaagca
agtggcaacagagctctttagcgatggcaccacaaactggggtcgtattgccagcctgctgacatttggggcaatgctgt
gcaaataccagaatgacagaggacatagcaagtatgtgaggttggtaggggaggagatctcgtcttatctacttacagag
cagcgggactggatactcagaaacaaagcatgggatggctttgtggagttttttcatgtcccggatacagaggcagctgt
gagaaacacacttctaacaattggtggtgtggctacattaagtgcagcacttgcctattggatacggtga
>gnl|bcl2dbcds|Q1L8X3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=768 residues).
atggctctgagtttggattttaggcgaacggccacgatgagcttcttcgcgcagggcgttcaaactccgacgctaaagac
gtgcgtcgaagacgaactggacggatacattgaggaggaggaggcgcctctgaagcggcttagaccgggtacaaacggcc
tgaaggggctgcagctggacggtcgatttgtttctgcgacagacggatctctaccgaccaccccagatccggaggagctc
gactacgccgaactggaacgcgatactcggcagctcttattggatttttaccgcacacacacgggaatgtgtccggtaga
ccgtaaactccatcacgccataccgacgatgaagcgagtggtcgacaatattctcgtgaagcaccagatcgcatacaaag
gaatgatccagcgtcttcagctggactctcagccggcctctctggacttcatcagatgtatagcaagcaccatgtttaaa
gatggcgtcactaactggggccgaattgcgagtctggtggcgttcggggccgtggtttgctctcgattgaaggagctcca
gcaggatcagtgtgtggagagggtggctgagcagatctcctcatatctgacctcagaacagcaggactggatcctcaaaa
acaagagctggcatgggttcgtggagtttttccaccaggaggacgtagagtctgttgtccgtcatggtctgttggcgctg
gtcggatgtgccggtatcggtgccggtctggccttcctcatccggtga
>gnl|bcl2dbcds|Q564A4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Danio rerio GN=BCL-2 (length=687 residues).
atggctaacgaaattagctatgacaatcggaatattgtggagaaatacctcaagcataaactttcaaagcgaggatatgt
gtggaaatgtcagtcctctgctgaggaagatgacaccttcaataaagcagtggaggaatcctctccaaactctgacagga
ggcttcaggctccctcagccggcggagggaacaactctgaatgcctgatagcccgggtcactcgttcagaccctcatttg
aggctctaccgggtgttacgggatgctggagatgaaatagaaaggatttaccaacgcgaatttgaggaaatgtcccaaca
aatggtgttcaacccaaattctgcgcaacgcagctttctaaccgtggccgaagagctctttagagacggagtgaactggg
ggcggatcattgcattcttcgagtttggtgggaccatgtgcgtggaaagcgtcaaccgggagatggcgtcccaggtagat
aatattgcacactggatgactgactacctgaacgggccactggaaaactggatcgaggaaaatggaggttgggatgcctt
cgtggagatgtacggtcagcagagagactctgtgttccacccgttttcatacctaacaaaagtgctcggcttggcggcgc
tgggcttggcaggagtgaccatcggagccttttttgctcagaagtga
>gnl|bcl2dbcds|Q568V1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=732 residues).
atgagcttcctcgcgcagggcgttcaaactccgacgctgaagacgtgcgtcgaagacgaactggacgggtacattgagga
ggaggaggcgcctctgaagcggcttagacctggtacaaacggcctgaaggggctgcagctggacggtcgatttgtttcta
cgacagacggatctctaccgaccaccccagatccagaggagctcgactacgccgaactggaacgcgatactcggcagctc
ttattggatttttaccgcacacacacgggaatgtgtccggtagaccgtaaactccatcacgccataccgacgatgaagcg
ggtggtcgacaatattctcgtgaagcaccagatcgcatacaaaggaatgatccagcgtcttcagctggactctcagccgg
cctctctggacttcatcagatgtatagcaagcaccatgtttaaagatggcgtcactaactggggccgaatcgcgagtctg
gtggcgttcggggccgtggtttgctctcgattgaaggagctccagcaggatcagtgtgtggagagagtggctgagcagat
ctcctcatatctgacctcagaacagcaggactggatcctcaaaaacaagagctgtcatgggttcgtggagtttttccacc
aggaggacgtagagtctgttgtccgtcatggtctgttggcgctggtcggatgtgccggtatcggcgccggtctggccttc
ctcatccggtga
>gnl|bcl2dbcds|Q568W5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=687 residues).
atgttcgctggaagaaacaacgacaacggcttttggccatgcactggattacaaagcaaaccactggttattccagaact
gaaagcgcataaccagtttgcggtggactctctccagggctcggtaccgtcctcgccttcggacgaaacgggggattatc
cccccaccgcccttgacatggacacgcgggagattattgacactttcttaataatctttacaggactccctcattctaaa
agtggacgaaaacaagtactgtcaacaatgaggcgggttgtggacaatctcgcggtgaagcacgagctcgcttacaaagg
tatgattgcacggctgaatctggagcagaaaggagaagatgtaagtttcatcaagcaagtggcaacagagctctttagcg
atggcaccacaaactggggtcgtattgccagcctgctgacatttggggcaatgctgtgcaaataccagaatgacagagga
catagcaagtatgtgaggttggtaggggaggagatctcgtcttatctacttacagagcagcgggactggatactcagaaa
caaagcatgggatggctttgtggagttttttcatgtcccggatacagaggcagctgtgagaaacacacttctaacaattg
gtggtgtggctacattaagtgcagcacttgcctattggatacggtga
>gnl|bcl2dbcds|Q8UWD6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=687 residues).
atgttcgctggaagaaacaacgacaacggcttttggccatgcactggattacaaagcaaaccactggttattccagaact
gaaagcgcataaccagtttgcggtggactctctccagggctcggtaccgtcctcgccttcggacgaaacgggggattatc
cccccaccgcccttgacatggacacgcgggagattattgacactttcttaaaaatctttacaggactccctcattctaaa
agtggacgaaaacaagtactgtcaacaatgaggcgggttgtggacaatctcgcggtgaagcacgagctcgcttacaaagg
tatgattgcacggctgaatctggagcagaaaggagaagatgtaagtttcatcaagcaagtggcaacagagctctttagcg
atggcaccacaaactggggtcgtattgccagcctgctgacatttggggcaatgctgtgcaaataccagaatgacagagga
catagcaagtatgtgaggttggtaggggaggagatctcgtcttatctacttacagagcagcgggactggatactcagaaa
caaagcatgggatggctttgtggagttttttcatgtcccggatacagaggcagctgtgagaaacacacttctaacaattg
gtagtgtggctacattaagtgcagcacttgcctattggatacggtga
>gnl|bcl2dbcds|Q90Z98_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Danio rerio GN=BCL2L1 (length=717 residues).
atgtcttactataaccgagaactggtggtattttttatcaaatataaactctcgcagaggaactacccctgcaaccacat
tggacttacagaagacacaaatcggactgatggggctgaagagaatggcgagggggcagcaggagcgacaactcttgtta
atggcaccatgaatagaacgaacgctagttccactgggaccccaccacaatcccctgcttcatccccccagcgtcaaaca
aatgggtctgggggtctagacgcagtgaaggaggcgctccgtgattctgccaacgagtttgagctgcgctattccagagc
attcaacgatctttcctcacagctccacatcacacccgccacagcgtaccagagcttcgagagcgtgatggatgaggtgt
ttcgcgacggcgtcaactggggccgaatcgtggggttgttcgcattcggaggggctctgtgcgtcgagtgtgtggagaag
gagatgagtccgcttgtgggacgcatcgcagaatggatgaccgtctacctagacaaccatattcaaccctggatccaaag
ccaaggaggatgggaacgctttgcagagatctttggaaaagatgcagcggcggaaagcaggaaatcgcaagaaagcttca
agaaatggttgtttgcaggaatgaccttgctcacgggtgtcgtcgttgggggactcattgcacagaaacgcctgtga
>gnl|bcl2dbcds|Q90Z98_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Danio rerio GN=BCL2L1 (length=717 residues).
atgtcttactataaccgagaactggtggtattttttatcaaatataaactctcgcagaggaactacccctgcaaccacat
tggacttacagaagacacaaatcggactgatggggctgaagagaatggcgagggggcagcaggagcgacaactcttgtta
atggcaccatgaatagaacgaacgctagttccactgggaccccaccacaatcccctgcttcatccccccagcgtcaaaca
aatgggtctgggggtctagacgcagtgaaggaggcgctccgtgattctgccaacgagtttgagctgcgctattccagagc
attcaacgatctttcctcacagctccacatcacacccgccacagcgtaccagagcttcgagagcgtgatggatgaggtgt
ttcgcgacggcgtcaactggggccgaatcgtggggttgttcgcattcggaggggctctgtgcgtcgagtgtgtggagaag
gagatgagtccgcttgtgggacgcatcgcagaatggatgaccgtctacctagacaaccatattcaaccctggatccaaag
ccaaggaggatgggaacgctttgcagagatctttggaaaagatgcagcggcggaaagcaggaaatcgcaagaaagcttca
agaaatggttgtttgcaggaatgaccttgctcacgggtgtcgtcgttgggggactcattgcacagaaacgcctgtga
>gnl|bcl2dbcds|Q9I9N3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=768 residues).
atggctctgagtttggattttaggcgaacggccacgatgagcttcttcgcgcagggcgttcaaactccgacgctaaagac
gtgcgtcgaagacgaactggacggatacactgaggaggaggaggcgcctctgaagcggcttagaccgggtacaaacggcc
tgaaggggctgcagctggacggtcgatttgtttctgcgacagacggatctctaccgaccaccccagatccggaggagctc
gactacgccgaactggaacgcgatactcggcagctcttattggatttttaccgcacacacacgggaatgtgtccggtaga
ccgtaaactccatcacgccataccgacgatgaagcgagtggtcgacaatattctcgtgaagcaccagatcgcatacaaag
gaatgatccagcgtcttcagctggactctcagccggcctctctggacttcatcagatgtatagcaagcaccatgtttaaa
gatggcgtcactaactggggccgaatcgcgagtctggtggcgttcggggccgtggtttgctctcgattgaaggagctcca
gcaggatcagtgtgtggagagggtggctgagcagatctcctcatatctgacctcagaacagcaggactggatcctcaaaa
acaagagctggcatgggtttgtggagtttttccaccaggaggatgtagagtctgttgtccgtcatggtcttttggcgctg
gtcggatgtgccggtatcggtgccggtctggccttcctcatccggtga
>gnl|bcl2dbcds|A0A1X9JZA1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Dicentrarchus labrax GN=BCL-2 (length=687 residues).
atggcgaacgagtgtaatcgcaacattgtggaaaagtatatctgccataaactctccaaacagggctacgagtgggggtt
tgacgctgtccggaatgcagatgccggtaataatgggtcaatagttgcccctccaccgagtttggtccgccggtgccgtg
gagccagcaccgggcccgacagcgagagcatcccccacctctgcacacggctcccccagtccgacccgcatgccgccatc
cacagagtcctacgcgaggctggagacgaacttgaaagactgtaccagccggacttcacggagatgtcgcggcagctgta
tctcacctccaccacggcgcagaggagattcgccgacgtgatagacgaactgttccgggacggggtgaactggggccgga
ttatcgctttcttcgagttcgggggcacggtgtgcgtggagtgcgtggcgaaggaggagatggcagcgcaggtgaacaac
atcgcggagtggatgactgagtatttaaatggacctctgaacagctggatacaagataacgggggatgggatgcctttgt
ggagctgtatgacagacagagggactccgtcttcagttgctcctggccctccattaagacggtcttcggtgtggctgcgc
ttggagcagctagcctcaccatcggagcgtaccttacacagaagtga
>gnl|bcl2dbcds|E6ZFR0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Dicentrarchus labrax GN=BCL2L1 (length=663 residues).
atgtcgtacagtaacagagagctggtggagttctttataagctataaactgtctcagaggaaccacccaacctctctact
gaggccggagaatgccggtgaaaggactgagggagacaaggccaactcagctgccagaaacggcttgctggccagcaaga
acacaagtggccagccggggacgtcttcgtcctcaggcgctgacatagaggctgtaaaggcagctcttcgggactcggca
gatgagtttgaactgctcttcacgcaagcgtttagtgacctttcctcgcagattgacatcactcctgacacggcctacca
cagctttaaaagcgtgatggacgaggtgttcaaggatggagtgaactggggacgtatagtgggcctgtttgcctttggcg
gtgtactgtgtgtagaatgtgtcgagaaagatatgagtgagctggtttcccgcatcgcagactggatgaccatgtacctg
gatgagcacatcagtccgtggatccagagccaaggaggatgggactgctttgctgaggtttttgggcgagacgccgccgc
agaagcgaggagatctcgggagactctgagtagatggctgctaattggggtggcgctgctaatgggagctgtggtcgggg
ttctcattgctaagaaacattga
>gnl|bcl2dbcds|A0A1S3EPX7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Dipodomys ordii GN=BCL2L1 (length=705 residues).
atgtctcagagcaaccgtgagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagagcaggactgaggacccagaaggaactgaatcggagatggagacccccagtgctatcaatggca
acccatcctggcacctggcggacagccccgcggtggtgaatggagccacgggtcacagcagcagttcggaagcccgggaa
gtgattcccatggcagctgtgaagcaagcgctgagggaggcaggcgatgagtttgaactgcggtatcgacgggcattcag
tgacctgacatcccagctccatattaccccggggacagcatatcagagctttgagcaggtagtgaacgaactcttccggg
atggggtaaactggggtcgaattgtggcctttttctccttcggcggggcactgtgtgtggaaagcgtagacaaggagatg
caggtattggtgagtcggatcgcaagttggatggccacttacctgaatgaccacctagagccttggatccaggagcacgg
cggctgggacacttttgtggaactctacgggaacaatgcagcagctgagagtcggaagggccaggagcgcttcaaccgct
ggttcctgacgggcatgaccgtggccggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A1S3F3I1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Dipodomys ordii GN=MCL-1 (length=1050 residues).
atgtttggcctcagaagaaacgcggtaatcggactcaacttctactgtgggggcgccgggctgggcgccggcagcggggc
cgccgccgcgccgggagggcggctcttgacggcggaggaggccagtgcccggcgggaggcggggggaggggaagccggcg
cggggattggcggaagcgccggcgcgagcccctcgaccaccctggcgccggacgcccggagggtcgcgcgtcccgcgccc
attggcgccgaggtccccgacgtcaccgggaccccaactaagcgggtgttcttcgcgcccacccaccgtgcgccgacgcc
ggacgagatggaagccgcggccgccggcgccatcatgtcgcccgaagaggagctggacggctacgaacccgagcccctgg
ggaagaggccggccgtcctgcccctgctggagctggtcggggaagccagtaagagctcgcgcacggacggctcgctccct
tccacgccgcctccagcggaggaggaggacgacgagttgtaccggcagtcgctggagattatctgtcgctaccttaggga
gcaagccacgggcgccaaggacgccaagccgctgggtggggccggcgcggccagcaggaaggcgctggagaccctgcggc
gggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaagac
gacgtcaaatctttatctcgagtgatgatccatgttttcagtgacggcgtaacaaactggggtaggattgtgactctaat
ttctttcggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagtatca
cagatgttctcgtaaggacaaaacgggactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccatgta
gaggacctagaaggcagcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatct
cataagatag
>gnl|bcl2dbcds|A0A1S3FYD8_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Dipodomys ordii GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctggtggctgactttgtaggctataaactgaggcagaagggtta
tgtctgtggagcgggccctggggagggcccagcagctgacccactgcatcaagccatgcgggcagctggagatgaatttg
agacccgcttccggcgcaccttctctgatctggcagctcagctgcatgtgaccccaggctcagcccagcaacgcttcacc
caggtctctgatgaacttttccaaggaggccccaactggggccgtcttgtggccttctttgtctttggggctgccctgtg
tgccgagagtgtcaacaaagaaatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcgcc
tggccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A219P0Y3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Epinephelus coioides GN=BCL2L1 (length=699 residues).
atgtgtcaaaacagagaactggtggtttgctacataaaatataaactaacccagagaaactatcctctcaaccacatggg
actcatagagcctccaaacaggactgatgggggggaggcagggttaggtgaggagcagcgggtagcgacacacgccaacg
ggacttttaatggcatgagtcccgggaccccgccagcatccccgctgcggcagcaacagttgccatcaacaacgagcctg
gacgcggtgaaagaggccctccgggactccgccaacgagtttgagctgcgatacgctcgcgccttcagcgatctgcacca
ccagctgcacatcacgccggccacagcctaccaaagcttcgagaacgtgatggatgaggtgttccgggacggagtcaact
ggggccgcatcgtagggcttttcgctttcggcggggcgctgtgcgtggagtgcgttgagaaggagatgagtccgttggtg
ggcaggatcatagagtggaagacccgctatctggacaaccacattcagccctggatccagagccaaagaggatgggagcg
cttcgccgaaatcttcgggcaggacgcggcggcagagagcaggaggtctcaggagagtttcaaaaagtggctgctggcgg
ggatgaccctggtgaccggagttgtggtgggctcactcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|F6PH48_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Equus caballus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggtta
tgtttgtggagctggccccggggagggcccagccgctgacccactgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccgggctcagcccagcaacgcttcacc
caggtctctgacgaactcttccaaggtggccccaactggggccgccttgtggccttctttgtctttggagccgcgctgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagactcggc
tggccgactggatccacagcagtggaggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacaggggccgtggcattgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|F6WQI0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Equus caballus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacaactggagtcagtt
tagtgacgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccacggggaatggagccactggccacagcagcagcttggatgcccgggaagtg
atccccatggcagcagtgaagcaagcgctgagggaggcaggcgatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacctggatggccacttacctgaatgaccacctagagccttggatccaagagaacggcgg
ctgggacacctttgtggaactctacgggaacaacgcggcagccgaaagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcactcttcagtcggaagtga
>gnl|bcl2dbcds|F6ZPD4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Equus caballus GN=BCL2L10 (length=483 residues).
ccggccacgcccgaggtggccgtgctgcgctgcgtggccgcccagatacagccccgcaaccagcgtgttctttcccgcta
ccgcggcttccgcggggaccacgtcgggctggcggcacggatggcgcaggcgatcttcggagaccgccacgtccccagct
ggggccgcgtggcggcgctcgtgaccctggcggggacgctgctggagagagccccgcggggaacctaccgaaagccgaag
cggggctacaagctggagctgagggagtggaaggccggcgtggaccgggacgctgcgcgcctggtggacttcctgtgcgc
atggctcaaggggcggcaccgcgcctggctggaggctcactatggctgggtgggcttttgtgacttctcactcacactgc
cagcttctcagaggatactgctggtccggtttcttctgtcatgcttttcagcatcagtcttaatctacctctggacaaaa
tta
>gnl|bcl2dbcds|F7AVA6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Equus caballus GN=MCL-1 (length=1053 residues).
atgtttggcctgaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggttgggggccggcggcggcgg
cgcctcgtcgccgggagggcggcttttggctgcggggaaggaggccacggcccggcgagagggagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgggagcccccagaccaccctcgcgccggactccctgagggtcgcgcggccctcc
cccattggcgccgagggccccgacgtcaccgcgccctcctccaggctgctgttcttcgcgcccacccgctgcgcgtcgcc
gcctgaggggatggaagccccggccgccgacgccatcatgtcgcccgaggaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccttgctggagtttgtccgggaggccagcagtggcccctgcacggacggctcgctc
ccctcgacgccgcccccagcagaggaggaggaggacgagttgtaccggcaatcgctggagattatctctcgttaccttcg
ggaacaggctaccggcaccaaggacacgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccctgc
ggcgggtcggggacggagtgcagcgcaatcacgagacggccttccaaggcatgcttcggaaactggacatcaaaaatgaa
gacgatgtcaaatctttgtctcgagtgatggcccacgttttcagtgacggagtgacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgtcctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggcgctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|F7CDX6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Equus caballus GN=BCL-2 (length=699 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcgggcgccgcgcccctgggggccacccccgtgccgggcatcttctcctcccagcccg
ggcgcacccccgcgcccgccaggacctccccgctgctacccccggccgcccccgccggcgccgcgggacctgccctcagc
cctgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgactttgccga
gatgtccagccagctgcacctgacgcctttcaccgcaaggggacgctttgccacggtagtggaggagctcttcagggatg
gggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcg
cccctggtggacaacatcgccctgtggatgactgaatacctgaaccggcacctgcacacctggatccaggataacggagg
ctgggacgcctttgtggaactgtacggccccagcatgcggccgctgtttgatttctcctggctgtctctgaaggcgctgc
tcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|F7CP56_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Equus caballus GN=BCL2A1 (length=525 residues).
atgaccgactgtgagtttggatatattcacatgctggcccaggactacctgaagtacgtcctgcagataccacaacctgg
atctggtccaagcaaaacatccagagtgttacaagacattgctttctcagttcaaaatgaagtagagaagaatttgaaac
catgcttggacaattttcatgttgtgtccatagatgctgccagaacaatattcaatcaagtgatggaaaagcaatttgaa
gatggcatcattaactggggaagaattatgaccatatttgcatttgaaggtattctcatcaagaaacttctaccagagcg
aattgccccagatgtggatacttacaaggagatttcttactttgttgctgagttcataacgaaaaacacaggagaatgga
taaggcaaaatggaggctgggaaaatggctttgtaaagaagtttgaacccaaatctggctggctgacttttctggaagtt
actggaaagatgtgtgaaatacttttcctgaagcaatactattga
>gnl|bcl2dbcds|A0A1S2ZQT6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Erinaceus europaeus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggcctcagaaggaactgaatcagagatggaaacacccagtgccatcaatggca
acccatcctggcacctggcggacagccctgcattgaatggagctactggccacagcagcagcctggatgcccgggaggtg
atccccatggcagccgtgaagcaagcgctgagggaggcgggtgatgagtttgaactaaggtatcggcgggcattcagtga
cctgacttcccagctccacatcaccccagcaacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaatggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagctgagagccgaaagggacaggagcgcttcaaccgctggt
tcctgacgggcgtgactgtggctggcttggttatgctgggctcactcttcagtcgaaaatga
>gnl|bcl2dbcds|A0A2I2UAE3_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Felis catus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggtta
tgtttgtggagcaggccctggggagggcccagcagctgacccactgcaccaagccatgcgtgcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatttggcagcccagttgcatgtgacccctgggtcagcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcactgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
tggccgactggattcacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacaggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|M3WHW2_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Felis catus GN=BCL2A1 (length=525 residues).
atggccgacggcgagtttgggtacgttctcacgctggcccgggactatacggagcacgttctgcaggggccccagcccgg
gtcccacccaagcagagtatcccaagtgctacaagacgtggccttctcggtccagggggaggtcgagaagaagttgaagc
cgtgcctggacaagttccatgtggtgtcggtagacacggccaggacgatattccaccaagtgatggaaaaggaatttgaa
gacggcatcattaactggggcaggattgtgactatatttgcgtttgagggcatcctcatcaagaagcttctccaggagcg
gatcgtcccagacgcggatgcgtttaaggtttcctactttgtcgccgagttcatcacgaaacacacgggagaatggatcc
ggcaaaacggaggctgggaaaacggctttgtaaggaagttcgaacccaagtctggctggctgacctttctggaagttaca
ggaaagatctgtaaggtattgtctctcctgaagaactactactga
>gnl|bcl2dbcds|M3WHW2_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Felis catus GN=BCL2A1 (length=435 residues).
atggccgacggcgagtttgggtacgttctcacgctggcccgggactatacggagcacgttctgcaggggccccagcccgg
gtcccacccaagcagagtatcccaagtgctacaagacgtggccttctcggtccagggggaggtcgagaagaagttgaagc
cgtgcctggacaagttccatgtggtgtcggtagacacggccaggacgatattccaccaagtgatggaaaaggaatttgaa
gacggcatcattaactggggcaggattgtgactatatttgcgtttgagggcatcctcatcaagaagcttctccaggagcg
gatcgtcccagacgcggatgcgtttaaggtttcctactttgtcgccgagttcatcacgaaacacacgggagaatggatcc
ggcaaaacggaggctggcactcagtacaagtttag
>gnl|bcl2dbcds|M3X1R9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Felis catus GN=BCL-2 (length=714 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtcatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggggacgcgggcgccgcgcccccgggggccgcccccgcgccgggcatcttctcctcccagcccg
ggcgcacccctgcgcccgccaggacctccccgccgccgcccccggtcgcccccgccgccgccgccgccgccgccgccgcg
ggccctgcgctcagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccg
ccgcgacttcgcggagatgtccagccagctgcacctgacaccctttaccgcaaggggacgctttgccacggtggtggagg
agctcttcagggatggagtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtc
aaccgagagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggat
ccaagacaacggaggctgggatgcctttgtggaactgtacggccccagcatgcagcctctgtttgatttctcctggctgt
ccctgaaggccctgctcagtctggccctggtgggggcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|M3XA94_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Felis catus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaagcaggcgctgagggaggccggggatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcggccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|M3XAP4_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Felis catus GN=MCL-1 (length=594 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggttggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggcgaccggcgccaaggacgcgaaaccactgggcgggtctggggcggccagcc
gaaaggcgttagagaccctccgacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcgg
aaactggacatcaaaaacgaaaacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaa
ctggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgca
tcgaaccattagcagaaagcatcacagatgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|M3XAP4_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Felis catus GN=MCL-1 (length=813 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggttggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggctgtggggaaggaggccacggccaggcgagaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcgcgcggccctcg
cccattggtgccgagggccccgacgtcaccgcgacccccccgaagctgctgttcttcgcggccacccgctgtgcgtcgcc
gcctgaaaagatggaaggcccagccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccagaacctc
tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagcagtggccccggcacagacggctcactg
ccctcgacgccacccccagcagaggaggaggaggacgagttgttccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgcgaaaccactgggcgggtctggggcggccagccgaaaggcgttagagaccctcc
gacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttttaa
>gnl|bcl2dbcds|M3XAP4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Felis catus GN=MCL-1 (length=1053 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggttggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggctgtggggaaggaggccacggccaggcgagaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcgcgcggccctcg
cccattggtgccgagggccccgacgtcaccgcgacccccccgaagctgctgttcttcgcggccacccgctgtgcgtcgcc
gcctgaaaagatggaaggcccagccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccagaacctc
tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagcagtggccccggcacagacggctcactg
ccctcgacgccacccccagcagaggaggaggaggacgagttgttccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgcgaaaccactgggcgggtctggggcggccagccgaaaggcgttagagaccctcc
gacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcggaaactggacatcaaaaacgaa
aacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|Q7YRZ9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Felis catus GN=MCL-1 (length=1053 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggttggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggctgtggggaaggaggccacggccaggcgagaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcgcgcggccctcg
cccattggtgccgagggccccgacgtcaccgcgacccccccgaagctgctgttcttcgcggccacccgctgtgcgtcgcc
gcctgaagagatggaaggcccagccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccagaacctc
tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagcagtggccccggcacagacggctcactg
ccctcgacgccacccccagcagaggaggaggaggacgagttgttccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgcgaaaccactgggcgggtctggggcggccagccgaaaggcgttagagaccctcc
gacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcggaaactggacatcaaaaacgaa
aacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|Q8SQ42_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Felis catus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcggtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcagacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtcaaacaagcgctgagggaggctggggatgagtttgaactgaggtaccggcgggcattcagtga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgctccaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|U3JSL7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ficedula albicollis GN=BCL2L1 (length=693 residues).
atgtacagcagtaatcgggagttagtgattgactttgtttcttacaagctctcacagaaaggctacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcaggggaggaggacgagatggacggcgtgctcaacggaagcccctcct
ggcacgcacccaccagccacatagtgaacggagcctccgtgcaccagagcagcctcgaagtccatgagatccgtcgagca
gccgacgtgaggcaggcgctgagagaggcgggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcacttc
ccagctccacatcactcccagcacagcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgttaaggagatgcgggtattggtg
aaacgcatcgtgtcttggatgaccacgtacttgaccgaccacttagatccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacgatgctgctgccgaggtgagaaaaggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggccggagtgcttctgctgggatcgctgctgagccgcaagtga
>gnl|bcl2dbcds|U3JTB2_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Ficedula albicollis GN=BCL2A1 (length=525 residues).
atggaaactgctgagttctattacgtttattacttagcccaggattatctgcagtatgtgctccaggaatcacacctcgg
accagcccagaccagggttgcccatgtcctgcgaaccatggcatcttccctgcaagaccaaaccgaggaggctctcaggc
cactcctggacaggattgacatcacctcagtagctgttgccaagagaattttcaatggagtcatggatgaaaagtttgct
gatggaaatactaactggggacgaattatgaccatatttacatttggaggtcttctcaccaagaagcttcaagagcatgg
ggttcagctgactgcagaggagaaggaggagatctcttatttcatcacagagtacatcatcaacaacaaatccgaatgga
ttgatgcaaatggtggctgggaaaatggcttcctaacaaagtttgaaagaagatcactactgtccttctccaaaattaca
gccctgttcatagctgttgtttccttgttcagagagtactactga
>gnl|bcl2dbcds|U3KEW4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ficedula albicollis GN=BCL-2 (length=720 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccggcgagcacagggcacccctgcctccaggtctctctgctcctgctgctgctgcggttgctgctg
ctgctgggacttcctctgatcacactgggccggtgtctccgcaccccgagccccccggctcggctgctgctagccccgcg
cccccggccgaggggctgcgccccgcaccccaggtcgtccacctggtcctgcgccaggcgggcgacgagttctcccggcg
ctaccagagggactttgcccaaatgtctggccagctgcacctgacgcccttcacggccaggagccgcttcgtggccgtgg
tggaggagctcttccgagacggggttaactggggcagaatcgtggccttcttcgagtttggcggcgtgatgtgcgtggag
agcgtcaacagggagatgtctccgctggtggacagcatcgccgcctggatgaccgagtacctgaaccggcacctgcacaa
ctggatccaggacaacggaggctgggatgcctttgtggagttgtatggcaacagtatgaggcctttgttcgatttctcct
ggatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatctcggacataagtag
>gnl|bcl2dbcds|U3KKY6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ficedula albicollis GN=MCL-1 (length=273 residues).
aaaaaaaataaaaaaaatctcccaggaatgctccgaaaactggaaatccagcaagaagaggacctgcagtcggtggtgga
ggtggctgcccacgtgttcagcgatggggtgaccaactggggacgtgtggtgaccctcattgcctttggagccttcgtgg
ccaagcacctgaagagcatcaagcaggagcagagcatcacttccctggctgggatcatcacagatgcactggtgtcctcc
aaacgccagtggctggagagccaggggggctgg
>gnl|bcl2dbcds|D2IT42_BCL2L10-02 BCL2-like 10 gene OS=[Eukaryota] Gadus morhua GN=BCL2L10 (length=588 residues).
atgtcgtgtaggctgtggaaagagaccctggccctgtcagaggactacctgttgtcctgcactgcaagcacaggcacagc
cccgccgcctcccagcgagtcagccgcggccatgaggggactggcccaggacatggagcggcagcactacgctcgcttcc
aggctctggcccagagcttcctggcccagtgcgaggccgacgcatgcgccggcctccgcaaggtgatggaggagctggtg
ggagacggacagttgaactgggggagggtagtttccctcttcacctttaccggggtgctggccagacaactgcaggagaa
gaagggggtacaactggggcaggaccccgggacgggcagggcactgggacaggttcccggcgggagctgcagggggctgg
cggagacgatagcggactacctaggggaggagaagagggactggctgctggagaacgggggctgggaagggttttgtaag
ttctccaggatcgcccgagaggtgaaccaagagtcttcgatgaagacggcgctgttcgcggccgccggggtgggcatcgc
aggcctgacgttccttttggtgcgctag
>gnl|bcl2dbcds|D2ITA0_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gadus morhua GN=MCL-1 (length=834 residues).
atgctgtcacagaaactaacttcaaactacggaaccagcttagtccagacctgctggtttaacagccctcaaaatggagg
cgaagagcgaaacatggacttccactccgaaggttcacacaccacgacagagggggccttgcctctaatggcgacgttca
aaagcggagacgaacgtaaaccaagacccacggaactaggaaggggcaggctggtgaacaaatcgcaagacgaccaagaa
ggaaacggttcgctgcctagcactccggaactccagtcagaagtagacacggacagccaggcgggggaagaagtgttgga
taacgacaccaagcgaatcattcgcatttttctcagagactatgcaggggcatcaaaagctaaaaggacaagacaagacg
aggttcaagtgactatgagaagagttgtagacggcgtgcttgaaaaacaccaatacgcatacaagggtatgatccagaaa
ttggaattggacggccgaggggaagacatgagttttgtcacgtctgtggccaagagtctcttcgcagacagcacaacaaa
ctgggggcgtatcgccagcctggtggccttcggagcagcgttgtgtcagtacctagaggccaggggtaaagaaggctgcg
tgtcgctggtggccgaggagatttcctcatacctcctttcagaccaacgggaatggttggtcaaaaacaactcatgggag
ggcttcgtagagttttttcgagtgtcagaccctgagacgacagtgagaaatacactcatggcctttgctggatttgctgg
tattggtgcaacaattgccctactaatcaggtga
>gnl|bcl2dbcds|D2ITA0_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gadus morhua GN=MCL-1 (length=834 residues).
atgctgtcacagaaactaacttcaaactacggaaccagcttagtccagacctgctggtttaacagccctcaaaatggagg
cgaagagcgaaacatggacttccactccgaaggttcacacaccacgacagagggggccttgcctctaatggcgacgttca
aaagcggagacgaacgtaaaccaagacccacggaactaggaaggggcaggctggtgaacaaatcgcaagacgaccaagaa
ggaaacggttcgctgcctagcactccggaactccagtcagaagtagacacggacagccaggcgggggaagaagtgttgga
taacgacaccaagcgaatcattcgcatttttctcagagactatgcaggggcatcaaaagctaaaaggacaagacaagacg
aggttcaagtgactatgagaagagttgtagacggcgtgcttgaaaaacaccaatacgcatacaagggtatgatccagaaa
ttggaattggacggccgaggggaagacatgagttttgtcacgtctgtggccaagagtctcttcgcagacagcacaacaaa
ctgggggcgtatcgccagcctggtggccttcggagcagcgttgtgtcagtacctagaggccaggggtaaagaaggctgcg
tgtcgctggtggccgaggagatttcctcatacctcctttcagaccaacgggaatggttggtcaaaaacaactcatgggag
ggcttcgtagagttttttcgagtgtcagaccctgagacgacagtgagaaatacactcatggcctttgctggatttgctgg
tattggtgcaacaattgccctactaatcaggtga
>gnl|bcl2dbcds|D2ITA2_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Gadus morhua GN=BCL2L1 (length=684 residues).
atgagcattgacacaagcatgtcgatcagtaacagagaactggtgttcttcttcctaagccataaactgtctcagaggaa
ttacaggcctattcccttccagcccgagggggcaggtgaggggactgatgaggacaagtccaacaggattggtaataatg
ggttacggttgaacgacggtaacggcaatggccagttggcgccatcacctactccacaaggcacggaggctgtgagggca
gcgcttctagaatcggtggaagagtttgagttgcgctacacgctggccttcagcgacctgtcgtcccagctgcccatcac
ccccgccacggcctacggtagcttcgaaagcgtgatggacgaggtgttcagggacagcatcaactggggacgcatagtgg
gcctgtttgccttcgggggggccctctgcgtggagtgtgtggagaaggagatgagccacatggtgccccgcgtggcagag
tggatgaccaggtacctggacgaccacattgaccactggatccagagcaacggaggatggaaacactttgctgcggtttt
tggaagcgacgcggcagcgggagcgaggcgtacccgggacagtcacaggagatggatgctggtgggcgcggcgctgctga
ctggggtgctgctcggggctctgctcgccaagaaacatgtctag
>gnl|bcl2dbcds|A0A1D5PQZ2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gallus gallus GN=MCL-1 (length=378 residues).
gaaaagtctaggggaatgcttcggaagctggaaatcaaaaaggaagatgacctgcaggctgtgtgtgaggtggctgctca
cgttttcaatgatggagtaacaaactggggccgagttgtcacgctcatctcatttggtgcctttgttgcaaaacacctga
aaagcatcaaccaagagaaatgcatcacctcgctggcggggatcatcacggacgcattggtctcatccaaacgcgagtgg
ctgatgagccagggaggctgggtgagtcactgcccaccacgaggctttcagaacgattcagtgtttcctatttccgtaac
ccactgggtgtcagctgcctgtgtcagcgaagtgcagatgagtcactgttccagttaa
>gnl|bcl2dbcds|A0A1L1RNM6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gallus gallus GN=MCL-1 (length=1008 residues).
atgtttgcagtcaagcggaacgccgtcatcggcttcaacctctactgcggcggaggaagcccgggcctggtgcccgcttc
accagcaggagagcaaaccccgccgcccgccgccgccgctccggccgccgccgccgccaccgtcgctgaggtaccgcggc
cgctgattggctccgcggggctgtgggccgccgccggccgcgccgaagccccccgcgctcccattggctccggggcggcc
ccccacgctccgatcggttccgccgcggcccgccgggcgccgccggactccacgtcgcggcccgtcgctctgtggagccc
cgaggaggagttggacggctgcgagcccgagtccgaacgcggccccggaggcgattcgttgcccggcacgccgcccgagc
tgcccgacttgatccccgacgagctgcggcaggaatccctggagctcatcctccggtacctccgggaggcggcgggagag
gccgagcccggcgttaaaaagctgtttccggggctcctgggagggccagggcggcccggcagggcgagcagcgccgtcat
ggagaaagcgctggaaacgttgcggagggtcggggacggcgtgatgcagaaacacgaattggccttccagggaatgcttc
ggaagctggaaatcaaaaaggaagatgacctgcaggctgtgtgtgaggtggctgctcacgttttcaatgatggagtaaca
aactggggccgagttgtcacgctcatctcatttggtgcctttgttgcaaaacacctgaaaagcatcaaccaagagaaatg
catcacctcgctggcggggatcatcacggacgcattggtctcatccaaacgcgagtggctgatgagccagggaggctggg
agggctttgttgacttcttccgagttgaggacctggaaagcagcatcaggaatgtgctgatggcctttgcaggagtggcc
ggcctgggggcgagcttggcctacatgatccgaaagtggaggagttga
>gnl|bcl2dbcds|A0A1L1RNM6_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gallus gallus GN=MCL-1 (length=996 residues).
atgtttgcagtcaagcggaacgccgtcatcggcttcaacctctactgcggcggaggaagcccgggcctggtgcccgcttc
accagcaggagagcaaaccccgccgcccgccgccgccgctccggccgccgccgccgccaccgtcgctgaggtaccgcggc
cgctgattggctccgcggggctgtgggccgccgccggccgcgccgaagccccccgcgctcccattggctccggggcggcc
ccccacgctccgatcggttccgccgcggcccgccgggcgccgccggactccacgtcgcggcccgtcgctctgtggagccc
cgaggaggagttggacggctgcgagcccgagtccgaacgcggccccggaggcgattcgttgcccggcacgccgcccgagc
tgcccgacttgatccccgacgagctgcggcaggaatccctggagctcatcctccggtacctccgggaggcggcgggagag
gccgagcccggcgttaaaaagctgtttccggggctcctgggagggccagggcggcccggcagggcgagcagcgccgtcat
ggagaaagcgctggaaacgttgcggagggtcggggacggcgtgatgcagaaacacgaattggccttccagggaatgcttc
ggaagctggaaatcaaaaaggaagatgacctgcaggctgtgtgtgaggtggctgctcacgttttcaatgatggagtaaca
aactggggccgagttgtcacgctcatctcatttggtgcctttgttgcaaaacacctgaaaagcatcaaccaagagaaatg
catcacctcgctggcggggatcatcacggacgcattggtctcatccaaacgcgagtggctgatgagccagggaggctggg
agggctttgttgacttcttccgagttgaggacctggaaagcagcatcaggaatgtgctgatggcctttgcaggagtggcc
ggcctgggggcgagcttggcctacatgatccggtga
>gnl|bcl2dbcds|Q00709_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Gallus gallus GN=BCL-2 (length=702 residues).
atggctcaccccgggagaagaggctacgacaaccgcgagatagtgctgaagtacatccactataaactctcgcagcgggg
ctacgactgggccgccggcgaggacaggccgcccgtgcccccggccccggctcccgctgctgctcccgctgcggtggctg
ctgctggagcctcctcccaccaccgccccgagccccccggctcggctgctgctagtgaggtgcccccggctgaggggctg
cgccccgcgcctcccggcgtccacctcgccctgcgccaggccggggacgagttctcgcgccgctaccagagggacttcgc
ccagatgtcgggccagctgcacctgacgcccttcacggcccacggccgcttcgtggccgtggtggaggagctcttccgtg
atggggtcaactggggccggatcgtcgccttcttcgagttcggcggcgtgatgtgcgtcgagagcgtcaaccgggagatg
tcgccgctggtggacaacattgccacctggatgaccgagtacctgaaccggcacctgcacaactggatccaggacaacgg
aggatgggatgcctttgtggaattgtacggcaacagtatgaggcctttgttcgatttctcctggatctctctgaagacca
tcctgagcctggttctggtgggagcttgcatcactcttggcgcttatcttggacataagtag
>gnl|bcl2dbcds|Q00709_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Gallus gallus GN=BCL-2 (length=699 residues).
atggctcaccccgggagaagaggctacgacaaccgcgagatagtgctgaagtacatccactataaactctcgcagcgggg
ctacgactgggccgccggcgaggacaggccgcccgtgcccccggccccggctcccgctgctgctcccgctgcggtggctg
ctgctggagcctcctcccaccaccgcccgagccccccggctcggctgctgctagtgaggtgcccccggctgaggggctgc
gccgcgcctcccggcgtccacctcgccctgcgccaggccggggacgagttctcgcgccgctaccagagggacttcgccca
gatgtcgggccagctgcacctgacgcccttcacggcccacggccgcttcgtggccgtggtggaggagctcttccgtgatg
gggtcaactggggccggatcgtcgccttcttcgagttcggcggcgtgatgtgcgtcgagagcgtcaaccgggagatgtcg
ccgctggtggacaacattgccacctggatgaccgagtacctgaaccggcacctgcacaactggatccaggacaacggagg
atgggatgcctttgtggaattgtacggcaacagtatgaggcctttgttcgatttctcctggatctctctgaagaccatcc
tgagcctggttctggtgggagcttgcatcactcttggcgcttatcttggacataagtag
>gnl|bcl2dbcds|Q07816_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Gallus gallus GN=BCL2L1 (length=690 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagagggggcactgctggagcgagct
ggaggaagaggatgagaacaggactgacactgcagctgaggcagagatggacagcgtcctcaatgggagcccatcctggc
acccccctgccggccacgtagtgaacggagccaccgtgcaccggagcagcctggaagttcatgaaattgttcgagcatcc
gacgtgaggcaggcgctgagagatgcgggggatgagtttgagctgaggtaccggagggctttcagcgacctcacctccca
gctccacatcacccctggcacggcgtaccagagctttgagcaggtagtgaatgaactcttccatgatggtgtgaactggg
ggcgcatcgtggctttcttctccttcggaggggctttgtgcgtggagagcgtggacaaggagatgcgggtactggtggga
cgcattgtgtcttggatgaccacgtacttgaccgaccatctagatccctggatccaggagaatggcggctgggagcgctt
tgtggatctgtatgggaacaacgctgctgccgagctgaggaagggccaggagaccttcaacaaatggctcctcaccgggg
cgaccgtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|Q07816_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Gallus gallus GN=BCL2L1 (length=573 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagagggggcactgctggagcgagct
ggaggaagaggatgagaacaggactgacactgcagctgaggcagagatggacagcgtcctcaatgggagcccatcctggc
acccccctgccggccacgtagtgaacggagccaccgtgcaccggagcagcctggaagttcatgaaattgttcgagcatcc
gacgtgaggcaggcgctgagagatgcgggggatgagtttgagctgaggtaccggagggctttcagcgacctcacctccca
gctccacatcacccctggcacggcgtaccagagctttgagcaggtagtgaatgaactcttccatgatggtgtgaactggg
ggcgcatcgtggctttcttctccttcggaggggctttgtgcgtggagagcgtggacaaggagatgcgggtactggtggga
cgcattgtgtcttggatgaccacgtacttgaccgaccatctagatccctggatccaggagaatggcggctgggtaagaac
tgctctcccatag
>gnl|bcl2dbcds|Q07816_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gallus gallus GN=BCL2L1 (length=690 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagagggggcactgctggagcgagct
ggaggaagaggatgagaacaggactgacactgcagctgaggcagagatggacagcgtcctcaatgggagcccatcctggc
acccccctgccggccacgtagtgaacggagccaccgtgcaccggagcagcctggaagttcatgaaattgttcgagcatcc
gacgtgaggcaggcgctgagagatgcgggggatgagtttgagctgaggtaccggagggctttcagcgacctcacctccca
gctccacatcacccctggcacggcgtaccagagctttgagcaggtagtgaatgaactcttccatgatggtgtgaactggg
ggcgcatcgtggctttcttctccttcggaggggctttgtgcgtggagagcgtggacaaggagatgcgggtactggtggga
cgcattgtgtcttggatgaccacgtacttgaccgaccatctagatccctggatccaggagaatggcggctgggagcgctt
tgtggatctgtatgggaacaacgctgctgccgagctgaggaagggccaggagaccttcaacaaatggctcctcaccgggg
cgaccgtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|Q9W6F2_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Gallus gallus GN=BCL2A1 (length=525 residues).
atggaaactgctgagttctattacgtttattatttagctcaagattatctgcagtatgtgcttcaggaatcacatctcgg
accagcccaaaccagagttgctcatgtcttgcgaaacattgcatcttcactccaagatcagacagaggaggctctcagac
ccttcttggacaggatcgatattacctccgtagatgttgccaagagaattttcaatggagtcatggaagaaaaatttgct
gatggaaatactaactggggacgaattatgaccatatttacttttggaggtcttctcaccaagaagcttcaagagcacgg
agttcagctcactggagaggagaaggagaagatttcttatttcatcacagagtacatcataaataacaaagccgcatgga
tagatgcaaacggtggctgggaaaacggtttcctaacgaagtttgaaagaagatcacccctatctttctctacaattaca
gacatatttgcagctgttctttccttgttcagagagtaccactga
>gnl|bcl2dbcds|G3NJY1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gasterosteus aculeatus GN=BCL2L1 (length=573 residues).
atgtctcaaaacagagaactggtggttttctacataaactataaactctcccagaggaacttacccctcaaccacatagg
gctgtccgagcctcccaacaggactggcgggggggtagaggcaggggcggctggtgggcagcggggagcgacgcactcca
acgggactttcaacggcacgagtcccgggaccccgccggcgtccccgctgctccagcaacggtcgccgtcgacggcgagc
ctggatgcggtgaaggaggccctgcgggactcggccaacgagttcgagctgcgatacgctcgggccttcagcgatctgca
caaccagctgcacatcacgccggccacggcctaccagagcttcgaggacgtgatggacgaggtgttccgggacggcgtca
actggggccgcatcgtggggctgttcgccttcggcggggcgctgtgcgtggagtgcgtggacaaggagatgagtccgctg
gtgggcaggatcgtcgagtggatgacgctctacctggacaaccacattcagccctggatccagaaccagggaggctggcg
ttcagacatttga
>gnl|bcl2dbcds|G3P7B4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gasterosteus aculeatus GN=BCL2L1 (length=663 residues).
atggcgaacattaacagggagctggtggagttcttcctaagctacaagctgtctcagaagaaccacccaacctctctgtt
gaggccggaggatgccggcggaaggacggagggagacaaggccaactcggcgtccgttcctggacgcgggagcagcgccg
gccagccggggatgtcgtcgccaccgccgccaccgtccggtgacaccgaggccgtaaaggcagctcttcaggactctgcg
aatgagtttgagctgctcttcacgcaagcgttcagtgacctctccttgcagctagacgtcacccccgacacggcctacca
cagcttcaagagcgtgatggacgaggtgttcaaggatggcgtcaactggggccgcgtggtgggcctgtttgccttcggcg
gcgtgctctgcgtggagtgcgtagagaaggacatgaccgagctggtgtcccgcatcgcggactggatgaccacgtacctg
gacgagcacatcagtgcttggatccagagccagggaggatgggactgttttgctgacattttcgggcgggacggcgcggc
agcggcgaggagatctcaggagacgatgagaaggtggctgctcgtcggggtggcgctgctaatgggagtgctcgtcggta
tggtcatggtcaagaagcggtga
>gnl|bcl2dbcds|G3PJT0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gasterosteus aculeatus GN=MCL-1 (length=957 residues).
atgaatataattcagagaccgaaactggccgcgttaaacatgaccggagtcatgagctgcattattctccctcaaaatgg
agtcgcgcccatgcgacagctcgcaatgggctcggcgaaggactcccacaacggcaacgcggggacaaacgacaccccga
agcggcccagcgccctcggggtgaactccgcgaacggctacccatcaaaaccgcagcgggaggacagcgaggacaccgac
aacgactcgctgccgtgcaccccggagtcggacagcgaaaccgacgtctccgactccccggcgggggccgcggctctgga
gagcgacacgaggcaactcctcggccgcttcctgagagaatttacgggactgtcgaaaacccagtggaacccgagcaggg
agctcaccaccatgaagagggtggtgggcgacgttttggagaagcacagatacgtattcaatggtatggtgaacaaattg
tcactggacgaccgaggcgacgacgccagtttcgtgcgggaggtcgccacgagcctcttcgcggacggcaccacgaactg
gggccgcatcgccagcctggtggccttcggggcggtggtgtgccaacacctggcggagcgaggccgggggaactgcgtgg
agctggtggggcaggagatctcggcctacctgctgtcggaccagcgggactggctgatcaaaaacaacgcctgggttggc
ttcgttgagttctttcgagtagcagacccagagtctgcggtgaggaacactctcatggctgtggctggattcgctagtat
tggggcgacactggccctgttgatcagtggaccttcaaaagtgcaaaggcagcttctcaccattgaattgttgcagatcg
tgcgctctcagaggggaggacaccggctgcagcgtgatgtgagcaccagaccttctccgacatccggctctggacta
>gnl|bcl2dbcds|A0A2I2YML2_BCL2A1-03 BCL2-related protein A1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2A1 (length=492 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatctgcagtacgtcctacagataccacaacctgg
atcaggtccaagcaaaacgtccagagtgctacaaaaggttgcgttctcagtccaaaaagaagtggaaaagaatctgaagt
catgcttggacaatgttaatgttgtgtccatagacactgccagaacactgttcaaccaagtgatggaaaaggagtttgaa
gacggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
aattgccccggatgtggatacttataaggagatttcatattttgttgcggagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggggaaatggcacaatcacacgcctatgctggtagagtcagtggcccacaagaagaggaaa
atggctttgtaa
>gnl|bcl2dbcds|A0A2I2YML2_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2A1 (length=591 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatctgcagtacgtcctacagataccacaacctgg
atcaggtccaagcaaaacgtccagagtgctacaaaaggttgcgttctcagtccaaaaagaagtggaaaagaatctgaagt
catgcttggacaatgttaatgttgtgtccatagacactgccagaacactgttcaaccaagtgatggaaaaggagtttgaa
gacggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
aattgccccggatgtggatacttataaggagatttcatattttgttgcggagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acgggaaagatctcaatactgttgaccagaaaggacactccatattgtgaaaccggcctaatttttctgactgttatgga
aacgattgccaacacatacttctacttttaa
>gnl|bcl2dbcds|A0A2I2YML2_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatctgcagtacgtcctacagataccacaacctgg
atcaggtccaagcaaaacgtccagagtgctacaaaaggttgcgttctcagtccaaaaagaagtggaaaagaatctgaagt
catgcttggacaatgttaatgttgtgtccatagacactgccagaacactgttcaaccaagtgatggaaaaggagtttgaa
gacggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
aattgccccggatgtggatacttataaggagatttcatattttgttgcggagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acgggaaagatctgtgaaatgctatctctcctgaagcaatactgttga
>gnl|bcl2dbcds|A0A2I2YPX6_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A2I2YPX6_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2L2 (length=1041 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggaccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
gcaaatcaaggttgactttaaggctatcatttgttcatctctgactcaggtgatcccaaaacgaaccaacagaccaggca
tcagcacaacagaccggggttttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgctctcgattc
tacagtggttttaacagcaggccccggggtcgcgtctacaggggccgggctagagcgacatcatggtattccccttacta
a
>gnl|bcl2dbcds|A0A2I2YQH7_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttagccaccggcgccaaggacacaaagccaatgggcaggtctggggcaaccagca
ggaaggcgctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2I2YQH7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttagctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatgacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggcaaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2I2YQH7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttagctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatgacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggcaaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|G3QES9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgagagatagtgatgaagtacatccattataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgtgcccccgggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatccagccgcatcccgggaccgggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtctcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|G3QLU6_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2L10 (length=615 residues).
atggttgaccagtggcgggagcgcaccaccatggccgacccgctgcgggagcgcaccgagcggttgctggccgactacct
ggggtactgcgcccgggaacccggcacccccgagccgacgccgtccacgcccgaggccgccgtgctgcgctccgcggccg
ccaggttacggcagattcaccggtccttcttctccgcctacctcggctaccccgggaaccgcttcgagctggtggcgctg
atggcggattccgtgctctccgacagccccggccccacctggggcagagtggtgacgctcgtgaccttcgcagggacgct
gctggagagagggccgctggtgaccgcccggtggaagaagtggggcttccagccgcggctaaaggagcaggagggcgacg
tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcatggggcagcaccgcgcctggctgcaggctcag
ggcggctgggatggcttttgtcacttcttcaggaccccctttccgctggctttttggagaaaacagctggtccaggcttt
tctgtcatgcttgttagcaacagccttcatttatctctggacacgattattatga
>gnl|bcl2dbcds|G3RY91_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggatacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|G3RY91_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctataagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A087WT64_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccgcccgggagggcgacttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgctgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgccgctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A087WT64_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccgcccgggagggcgacttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgctgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgccgctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A087WT64_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccgcccgggagggcgacttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggcgctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A9QXG9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Homo sapiens GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacggggtacgataaccgggagatagtgatgaagtacatccattataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgcccccgggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatccagccgcatcccgggacccggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgagccacaagtga
>gnl|bcl2dbcds|B4DU51_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=840 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccgcccgggagggcgacttttggctacggagatggaagccccggccgctgacgccatcatgtcgcccgaagagg
agctggacgggtacgagccggagcctctcgggaagcggccggctgtcctgccgctgctggagttggtcggggaatctggt
aataacaccagtacggacgggtcactacccttgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtc
gctggagattatctctcggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggcca
ccagcaggaaggcgctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatg
cttcggaaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgt
aacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
gctgcatcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggc
tgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgt
tgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|B4E1X9_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Homo sapiens GN=BCL2A1 (length=492 residues).
atgacagactgtgaatttggatatatttacaggctggctcaggactatctgcagtgcgtcctacagataccacaacctgg
atcaggtccaagcaaaacgtccagagtgctacaaaatgttgcgttctcagtccaaaaagaagtggaaaagaatctgaagt
catgcttggacaatgttaatgttgtgtccgtagacactgccagaacactattcaaccaagtgatggaaaaggagtttgaa
gacggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
aattgccccggatgtggatacctataaggagatttcatattttgttgcggagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggtatgtgtgatggaaaaattcttcattgttctttcctgtgaaatagaaattgagaatttc
cttgctagttaa
>gnl|bcl2dbcds|B4E3L8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=723 residues).
atggaagccccggccgctgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagcg
gccggctgtcctgccgctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcactaccctcgacgc
cgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcgggagcaggcc
accggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttacgacgggttgg
ggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtga
aatcgttgtctcgagtgatgatccatgttttcagcgacagcgtaacaaactggggcaggattgtgactctcatttctttt
ggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgt
tctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacc
tagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
tag
>gnl|bcl2dbcds|C8YZ26_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccgcccgggagggcgacttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggcgctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
agactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccaagtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaaaaagatag
>gnl|bcl2dbcds|Q9HD36_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Homo sapiens GN=BCL2L10 (length=615 residues).
atggttgaccagttgcgggagcgcaccaccatggccgacccgctgcgggagcgcaccgagctgttgctggccgactacct
ggggtactgcgcccgggaacccggcacccccgagccggcgccatccacgcccgaggccgccgtgctgcgctccgcggccg
ccaggttacggcagattcaccggtcctttttctccgcctacctcggctaccccgggaaccgcttcgagctggtggcgctg
atggcggattccgtgctctccgacagccccggccccacctggggcagagtggtgacgctcgtgaccttcgcagggacgct
gctggagagagggccgctggtgaccgcccggtggaagaagtggggcttccagccgcggctaaaggagcaggagggcgacg
tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcatggggcagcaccgcgcctggctgcaggctcag
ggcggctgggatggcttttgtcacttcttcaggaccccctttccactggctttttggagaaaacagctggtccaggcttt
tctgtcatgcttgttaacaacagccttcatttatctctggacacgattattatga
>gnl|bcl2dbcds|Q9HD36_BCL2L10-02 BCL2-like 10 gene OS=[Eukaryota] Homo sapiens GN=BCL2L10 (length=726 residues).
atggttgaccagttgcgggagcgcaccaccatggccgacccgctgcgggagcgcaccgagctgttgctggccgactacct
ggggtactgcgcccgggaacccggcacccccgagccggcgccatccacgcccgaggccgccgtgctgcgctccgcggccg
ccaggttacggcagattcaccggtcctttttctccgcctacctcggctaccccgggaaccgcttcgagctggtggcgctg
atggcggattccgtgctctccgacagccccggccccacctggggcagagtggtgacgctcgtgaccttcgcagggacgct
gctggagagagggccgctggtgaccgcccggtggaagaagtggggcttccagccgcggctaaaggagcaggagggcgacg
tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcatggggcagcaccgcgcctggctgcaggctcag
ggcggctgggtgagcacgcggcggacaccgggacacggggcgggacgggcagccgggaagcgcccacgaggctggcacgg
atggcttttgtcacttcttcaggaccccctttccactggctttttggagaaaacagctggtccaggcttttctgtcatgc
ttgttaacaacagccttcatttatctctggacacgattattatgagttttaaaacttttaacccgcttctacctgcccaa
ctgtga
>gnl|bcl2dbcds|B4DG83_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=723 residues).
atggaagccccggccgctgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagcg
gccggctgtcctgccgctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcactaccctcgacgc
cgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcgggagcaggcc
accggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttacgacgggttgg
ggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtga
aatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgactctcatttctttt
ggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgt
tctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacc
tagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
tag
>gnl|bcl2dbcds|B4DLY8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=717 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccgcccgggagggcgacttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttacgacgggttggggatgg
cgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtgaaatcgt
tgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgactctcatttcttttggtgcc
tttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgt
aaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaag
gtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A287CZ07_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2L1 (length=675 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagaacaggactgaagccccagaagggactgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcatctggccgacagccccgcgataaatggagccactggtcacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcattgagggaggcaggcgacgagtttgaactgtggtactggcgggcattcagtga
cctgacgtcccagctccacatcaccctggggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcacattgtggcctttctctcctttggcggggcactgtgcatggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatgccttggatccaagagaacggcggctgggacacttttgtggaactctacag
gaataatgcggcagcagagagccggaagggccaggagcgcttcaaccgttggttcctgacgggcatgactgtggccggtg
tggttctgctgggctcacttttcagtcggaaatga
>gnl|bcl2dbcds|A0A287DCH9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=MCL-1 (length=1002 residues).
atgttcggccttaagaggaacgcggtcatcggactcaacctctactgcgggggcgccgggctgggggccagcggcggcgc
caccccgccgggagcgcagctcttagccgccgagaaggaggccgcggcccggcgagaggcagggggaggggaagccgccc
agccgcccagcgcccgcagggtcgcgcggccggtgcccattggcgccgaggtccccgacgtcaccgcgaccccggcgagg
cgactctttttcgcgcccacctactgcgtgtcgccgcctgagaagatggaagcccccgccgccgccatgtcgcccgaaga
ggagctggacggctacgagcccgagcccctcgggaagcggccggcggtcctgcccttgctggagctcgttggagaggccg
ccaagagtcccggcgcggacgggtcgctgccctcgacgccgccgcccgcggaggaggaggacgacgagctgtaccggcag
tcgctggagatcatttcgcggtacctccgcgagcaggcgaccggctccaaggacgcgaagccgctgcgtgggtcgggggc
cgccagcaggaaggcgctggagaccctgcggcgggtcggcgacggagtgcagcgcaaccacgagacggccttccaaggca
tgcttcggaagctggacatcaaaaacgaggatgatgtcaagtctctgtctcgcgtgatggtccatgttttcagtgacgga
gtaacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaaga
aagctgcattgaacccttagcagaaagtatcacagacgtgctcgtaaggacaaaacgggactggctggtcaaacaaagag
gctgggatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggctttcgcaggt
gttgctggcgtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A287DCH9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=MCL-1 (length=852 residues).
atgttcggccttaagaggaacgcggtcatcggactcaacctctactgcgggggcgccgaggtccccgacgtcaccgcgac
cccggcgaggcgactctttttcgcgcccacctactgcgtgtcgccgcctgagaagatggaagcccccgccgccgccatgt
cgcccgaagaggagctggacggctacgagcccgagcccctcgggaagcggccggcggtcctgcccttgctggagctcgtt
ggagaggccgccaagagtcccggcgcggacgggtcgctgccctcgacgccgccgcccgcggaggaggaggacgacgagct
gtaccggcagtcgctggagatcatttcgcggtacctccgcgagcaggcgaccggctccaaggacgcgaagccgctgcgtg
ggtcgggggccgccagcaggaaggcgctggagaccctgcggcgggtcggcgacggagtgcagcgcaaccacgagacggcc
ttccaaggcatgcttcggaagctggacatcaaaaacgaggatgatgtcaagtctctgtctcgcgtgatggtccatgtttt
cagtgacggagtaacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagagca
taaaccaagaaagctgcattgaacccttagcagaaagtatcacagacgtgctcgtaaggacaaaacgggactggctggtc
aaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggc
tttcgcaggtgttgctggcgtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|I3MCZ7_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2A1 (length=528 residues).
atgaatgactgtgagttcaggttcatccacacgctggctcaggactacctgcagcacgtcctgcaggtaccgcaacgtgg
gtcaagccccagcaaaacgtccaaagtgttacaaaacgtggctttctcagtccaaaaagaagttgaaaagaatctgaaac
cattcttggacaattttgatgtggtgtctgctgatactgccagaacaatattcaatcaagtgatggaaaaggaatttgaa
gatggcatcatgaactggggaaggattgtgaccatatttgccttcggaggagttctggtcaagaaacttctgcgagagcg
gattgcccctgctgtggattccgatgaggagatctcttactttgtggctgagttcattatgaataatgcaggagaatgga
taaggcaaaatggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggttgacttttctgggagtt
acagggcagatctgtgagatgctgtctctcctgaagcaatactattga
>gnl|bcl2dbcds|I3MUP5_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagaacaggactgaagccccagaagggactgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcatctggccgacagccccgcggtaaatggagccactggtcacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcattgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacgtcccagctccacatcaccccggggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaataatgcagcagcagagagccggaagggccaggagcgcttcaaccgttggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcgcttttcagtcggaaatga
>gnl|bcl2dbcds|I3MUP5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagaacaggactgaagccccagaagggactgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcatctggccgacagccccgcggtaaatggagccactggtcacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcattgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacgtcccagctccacatcaccccggggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaataatgcagcagcagagagccggaagggccaggagcgcttcaaccgttggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcgcttttcagtcggaaatga
>gnl|bcl2dbcds|I3MUP5_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagaacaggactgaagccccagaagggactgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcatctggccgacagccccgcggtaaatggagccactggtcacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcattgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacgtcccagctccacatcaccccggggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaataatgcagcagcagagagccggaagggccaggagcgcttcaaccgttggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcgcttttcagtcggaaatga
>gnl|bcl2dbcds|I3MVK9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL-2 (length=588 residues).
atggctcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcacagagggg
ctacgagtgggatgctggagacgtgggcgctgcgtccccaggagccgcccccgggccgggcatcttctcttcccaaccgg
ggagccataccccggccgccaggacctcgccaccgccacccccggctgcccccgctgccgccgcggggcccgtgctcagc
ccggtgccacctgtggtccacctgaccctccgccaggccggcgatgacttctctcgtcgctatcgtcgcgacttcgccga
gatgtccagtcagctgcacctgacgcccttcaccgcaaggggacgctttgccacggtggtggaggagctcttcagggatg
gggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcg
cccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggataacggagg
ctgggtaggtgcacgtcgggttgaatga
>gnl|bcl2dbcds|I3ND50_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggccgactttgtaggctataagctgaggcagaagggtta
cgtctgtggagctggccctggggagggcccagcagctgatccactgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcagctcagctgcatgtgaccccgggttcagctcagcaacgcttcacc
caggtctctgacgaacttttccaagggggtcccaactggggtcgtcttgtggccttctttgtctttggggctgccctgtg
tgctgagagtgtcaacaaagagatggagccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcacgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|I3ND50_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2L2 (length=507 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggccgactttgtaggctataagctgaggcagaagggtta
cgtctgtggagctggccctggggagggcccagcagctgatccactgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcagctcagctgcatgtgaccccgggttcagctcagcaacgcttcacc
caggtctctgacgaacttttccaagggggtcccaactggggtcgtcttgtggccttctttgtctttggggctgccctgtg
tgctgagagtgtcaacaaagagatggagccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctggctgttctccagggggaatatgggggctctgattggaggctgggacagc
tgtgctgggaaggaggcatggggctga
>gnl|bcl2dbcds|H3AAS7_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Latimeria chalumnae GN=BCL2L2 (length=570 residues).
atggattcgctttacagtaacagaggagtggtggaggacttcatttattacaaactcggccagaaggggtactctcagca
gggtgccccaacggatccccccgccaacccactctaccgtgccatgcgggaggcgggggatgagtttgaggcccgcttcc
accgcaccttcaactccttgtcgtcacaccttcacatcacaccgggcacggcttaccggcgatttgctgagacggcagac
agcctcttccaggatggggtgaactggggccgggtggtggcgctgttcgtcttcagcgcagcactctgtgtggagagcgt
ggataaggaaatggcttcgctggtgggacggattattgactggacagtaacttatgtagagagcagccttcaggattgga
tcaaccacagtggaggatggagtgctttcgtgtgtctgtatgggaatggtgcagtgggcggagccaggaggtttcaggaa
ggctactggtcatccatgaagacggttgtgacgggggctgtggcgctaggggcggtgatgacggtcggagcgctttttgc
cagcagataa
>gnl|bcl2dbcds|H3AAS7_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Latimeria chalumnae GN=BCL2L2 (length=570 residues).
atggattcgctttacagtaacagaggagtggtggaggacttcatttattacaaactcggccagaaggggtactctcagca
gggtgccccaacggatccccccgccaacccactctaccgtgccatgcgggaggcgggggatgagtttgaggcccgcttcc
accgcaccttcaactccttgtcgtcacaccttcacatcacaccgggcacggcttaccggcgatttgctgagacggcagac
agcctcttccaggatggggtgaactggggccgggtggtggcgctgttcgtcttcagcgcagcactctgtgtggagagcgt
ggataaggaaatggcttcgctggtgggacggattattgactggacagtaacttatgtagagagcagccttcaggattgga
tcaaccacagtggaggatggagtgctttcgtgtgtctgtatgggaatggtgcagtgggcggagccaggaggtttcaggaa
ggctactggtcatccatgaagacggttgtgacgggggctgtggcgctaggggcggtgatgacggtcggagcgctttttgc
cagcagataa
>gnl|bcl2dbcds|H3ANS8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Latimeria chalumnae GN=BCL2L1 (length=720 residues).
aaaatgtccttcaacaggttgctggtggtggaccatatatcccagaagctgatgcagcggggataccagtggagggaggt
tggtgagcaggaccacggtggtggaggagaccgcgcgagggaagcacagactcccgaggagggggccattccaggcatgg
acccacccaacggcagccaccctcatgcaggactcaatggtgcggttaacgggttgccggctggcagcagcagccgcctg
gaagcccaggcggtgtcggggcccgaagccgtgaaacggacattgcgagaggccggggaagagtttgagctgaggtatag
ccgagcattcagtgacctctcttcccagctccacatcacccccggcacagcctaccagagctttgaacaggtggtgaacg
aactcttccgggacggagtgaactgggggcgcgtggtggctttctttgcctttggaggggcgttgtgtgtggagagtatg
gacaaggagatgtcttcactagtagagcggatcgctgagtggatgacgacttacctagatgataacttaaacccttggat
tcaggaacaaggaggatgggcaaccataatacacattgacggggttgacgctatgcagcgctcaaacaccaggagtgaaa
aattgggttttgttgggttttttttttcctttcttctgcgtggggtggaaagaaacctcaaactctttttgcgcaaatga
>gnl|bcl2dbcds|H3AR18_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Latimeria chalumnae GN=MCL-1 (length=591 residues).
atggaattaccgggggacgggtgcccgcaggacggggacatggcggagtttcgcaaggagacgctgaagctgttgcggag
ttacttgtgcgaggtggcgggctgcgagagcacggagacggccttcaggttcggtctagatcagtggagcggtggcgaga
agccgctggacaccctccggcgggtcggggatagcatcatagacaaacaccgcatcgcctttaatggaatgcaacaaaag
ctaaacatccataaggaggacgacctccacattatacccgaaattggtaaccagatctttaaggacggtgcaacaaactg
gggtcgcattgttagtcttattgcttttggagcagtcgttgccaagaagctcaaaaagatgaacctggaagacagcattg
aacagttggcagtgtcgatcacagactttctggtgcagaataagggagactggatcctcaagaaccaaggctggaaagga
tttgttgactttttccatgtagaagatgcagagggtacaatcaaaaatgtattgatgacatttgcgggcgttgctggact
gggtgcaagtctggtctacttgatgagatga
>gnl|bcl2dbcds|H3AR18_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Latimeria chalumnae GN=MCL-1 (length=624 residues).
ggttacaacgccgacggctccgtgccgccttcgccgcccaccccgtcgacccccgaggacggggacggggacatggcgga
gtttcgcaaggagacgctgaagctgttgcggagttacttgtgcgaggtggcgggctgcgagagcacggagacggccttca
ggttcggtctagatcagtggagcggtggcgagaagccgctggacaccctccggcgggtcggggatagcatcatagacaaa
caccgcatcgcctttaatggaatgcaacaaaagctaaacatccataaggaggacgacctccacattatacccgaaattgg
taaccagatctttaaggacggtgcaacaaactggggtcgcattgttagtcttattgcttttggagcagtcgttgccaaga
agctcaaaaagatgaacctggaagacagcattgaacagttggcagtgtcgatcacagactttctggtgcagaataaggga
gactggatcctcaagaaccaaggctggaaaggatttgttgactttttccatgtagaagatgcagagggtacaatcaaaaa
tgtattgatgacatttgcgggcgttgctggactgggtgcaagtctggtctacttgatgagatga
>gnl|bcl2dbcds|E2IV76_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Lemur catta GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tatcgatgcagaagagaacaggactgaggccccagaagggactgaatcggagatggaaacccccagtgccattaatggca
acccatcctggcacctggcagacagccctccagcgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccctatggcagcagtgaagcaagcactgaaggaggcgggcgatgagtttgaacttcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccctagggacagcatatcaaagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggccctatgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggctggcgtggttctgctgggctcgcttttcagtcggaaatga
>gnl|bcl2dbcds|W5MG74_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Lepisosteus oculatus GN=BCL2L1 (length=669 residues).
aagatgtcatacagcaacagagacctcgtcgtctactacatcaactataaactctcgcagaagaactactcctgggacca
gttcagcctggagggcaggaccggaggcgctgaggcggtgggttcggggagcccgaacgcagaggagcgtacgaacggcg
cggccaatggcgggggggggcccgtgtcgcgccagcccccccaggggatcgaggcggtgcagggggcgctgcgcgactcc
gccaacgagtttgagctccgctacggccgggcgttcagcgacctgtcctcccagctccacatcacgcccgccaccgccta
ccagagcttcgagcacgtcatggacgaggtcttccgggacggggtgaactgggggcgcatcgtggggctcttcgctttcg
ggggtgcgctgtgcgtggagtgcgtggagaaggagatgagcaacctggtgagccgcatagccgagtggatgaccgtctac
ctggacaacaacattcagccctggatccagagtcagggaggatgggacaggtttgcggagatctttggcaaggatgcggc
tgcggagtaccggagatcacaggagagcttcaagaagtggctgctggcgggcatgactctggttacggggctggtggtgg
gctcctacatcgccaagaaacgcttatag
>gnl|bcl2dbcds|W5MMB7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Lepisosteus oculatus GN=MCL-1 (length=882 residues).
atgagcctctcctcgctgaagcgcacctcggccagcgccgtgatacagctctattgccccaacgccaccaccattcaccc
cggcctcgccagcctggggccctgtccgggcgggtccgccgcccgcacggctgtcctggaccccatgctcaaggcggact
acgccgaggacgaactggacaactactcggcggagcccgtggcgaccagcgcctggatccccaagtcgccgcggtcgctg
cccgcggggctgaagctgggcggccacttcccggagagcggccacgccgacgggtccctgccctccaccccggacacccc
gctggactgcggcagcgtccccgagttcctctccgaggcccacgggcagctgaacgcggagacccgggagttaatcggga
cctttttgcagatgtacacggggttgccgcaccgccggagccgaggcaaggccctggagaccctgaagcgcgtcgtggac
agtgtggtggcgaagcatcagatcgcctaccacggcatgatcgcgaagctggagctggagaacaagggtgaggacgtgag
cttcgtgacgggcgtggccaaaagcttgttcagcgacgggaagaccaactggggccgcatcgccagcctggtgtcgttcg
gcgcggtggtggccaagcagatgaaggactcgggccgggagagctgcgtggaggcggtgggccaggcgatctccaactac
ctactgcaggaccagcgcgagtggcttctgaacaaccgaggctgggacggcttcgtggagttcttccgcgtggaggaccc
cgagtcgacgatcaggaacgccctgatggcgtttgccggggtggcggggctgggcgcggggctggccctgctgatcagat
ga
>gnl|bcl2dbcds|W5N4F7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Lepisosteus oculatus GN=BCL-2 (length=696 residues).
atggcaaataacgaagccccgtacgatactcggaatatcgtgacaaaatacatccatcacaaactcctgaagaagggcta
cgtgtgggaatcccgcgtgtccggcgagaccgatccccccaataacggattggtgggcccctccgcctcgggtccggggc
tgcaggcgcggcggctccaggctgccggggccgagcgcggagctgtcccggtcccccgccggacccccccgcccgacccc
cacgccgctctccacaaggtgctgcgggaggctggggacgagatcgagaggatgtaccaccgggacttcgcggagatgtc
ggatcagttgcacttcacccccaacaccgcccggaggaagttcaccgcggtggtggaggagctgtttcgggacggagtca
actgggggcggattgtcgctttcttcgagttcggcgggacgatgtgcgtggagagcgtgaaccgggagatgacgtcccag
gtggacaacattgccaactggatgacggagtatctcaacgggccccttcagaactggatccaggagaacggaggctggga
cgcctttgtggagctctatgggagacagagaggctccatgttcagctgttcatggccatctttgaagactttctttggtc
tagctgctctgggcgcagcaggcctgaccgttggagcctactttacacaaaaatga
>gnl|bcl2dbcds|Q4U2V6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Lonchura striata GN=BCL2L1 (length=693 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagaaaggatacagctggagtcagct
ggaagaggaggatgagaacaggactgactttgcaggggaggaggacgagatggacggggtcctcaacgggagcccctcct
ggcacgcggccaccagccacatagtgaatggagccaccgtgcaccagagcagcctcgaagtccatgagatccgtcgagca
gccgatgtgaggcaggcgctgagagaggcaggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcacttc
ccagctccacatcactcccagcacagcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgttaaggagatgagggtattggtg
aaacgcatcgtgtcttggatgaccacgtacttgaccgaccacttagatccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacgatgctgctgccgagatgagaaaaggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|G3SPN0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Loxodonta africana GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagttggagtcagtt
tagtgatgtggaggagaataggactggggcctcggaaggcactgaatccgagatggagatccccagtgccatcaatggca
acccatcccggcacctggcagacagccctgcggtgaatggagctactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcagtgaagcaagctctgagggaggcaggcgatgagttcgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggctacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggtaaggaccacgccccttttgtgcttcagtacctcagtgaaggaagacatagcctatgtgttcattcaggtcaaaa
cctatgcaagtgggaagttagtccagtgtttcctcaccctgacacaatggttcaccacccaa
>gnl|bcl2dbcds|G3T756_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Loxodonta africana GN=MCL-1 (length=1026 residues).
atgttcggcttcaagagaaacgcagtaatcggactcaacctttactgtgggggggccggcttgggggccggcggctgcgc
cacccctccgggagggcgacttccagctcctggaaaggaggccacggcccggcaagaggtagggggaggggacgccggcg
cgagccccccggccgctgtcgctccggacggccggagggtcgtgcggccggcgcccattggcgccgagggccccgacgtc
actgcgattcccgcgaggccgacgttctttgcgcccacccgccgcgcgtcgccgcctgtggagatggaggctctagccgc
cgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagccgctcgggaagcggccggctgtttttcccc
ggctggggctggtcggggaggccagtaatggccccggtaccgacgggtcactaccctcgacgccgcccctagcagaggag
gaggaggacgagttgtaccggcagtcgctagagattatctctcggtaccttcaggagcaggcaaccggcgccaaggacac
caagccaatgggcgggtctggggcggccagcaggaaggcgttagagaccctccggcgagtcgcggacggggtgcagcgca
accacgagacggccttccaaggaatgcttcggaaactggacatcaaaaacgaagatgatgtcaaatctttatctcgagta
atggcccatgttttcagtgacgggataacaaactggggcagaattgtgactctcatatcttttggtgcctttgtggccaa
acacttgaagagcgtaaaccaagaaagccgcatcgaaccattagcagaaagtatcacagatgttctcgtaaggacgaaaa
gggactggttagtcaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcaga
aatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|G3T8E6_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Loxodonta africana GN=BCL2A1 (length=528 residues).
atgactgactgtgagtttggatacatttacaagctggtccaggactatctgaagtacgtcctgcagataccacaacctgc
agctggttcaagcaaaacgtccagagtgttacaaaatgtggctttctcagttcaaaaagaagttgaaaagaatttgaaac
cctgcttggacaattttgttgtcatctccattgataccgcccaaacaatattcaagcaagtgatggaaaaggaatttgaa
gatggcatcattaactggggaagaattgtgaccatatttgcatttggaggtattctcatcaagaaacttctaagggagcg
aattgccccagatgtggatacttacaagaagatttcttcttttgttgctgagttcatagtggataacacagcagagtgga
taaggcaaaacggaggctgggaaaatggctttgtgaagaagtttgaacctaggtctggctggctgacttttctggaagtt
acaggaaagatttgtgaaatgttatttctcctgaagcaatactattga
>gnl|bcl2dbcds|G3TMU7_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Loxodonta africana GN=BCL2L2 (length=627 residues).
tatattcatgttagtctttcatccctgactcttgcagccgcccgcatggcgaccccagcctcagccccagacacacgggc
tctggtggcagactttgtgggctacaagctgaggcagaagggttatgtttgtggagctggccccggggagggcccagcag
ctgacccgctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccggcgcaccttctctgatctggca
gcccagctgcatgtgaccccaggctcagcccagcaacgcttcacccaggtctctgatgaactcttccaagggggccccaa
ctggggccgccttgtggccttctttgtctttggggctgctctgtgtgctgagagtgtcaacaaggagatggagccactgg
tgggacaagtgcaggagtggatggtggtctacctggagacgcggctggctgactggatccacagcagtgggggctgggcg
gagttcacagctctatacggggacggggccctggaggaggcacggcgtctgcgggaggggaactgggcatcagtgaggac
agtgctgacgggggctgtggcactgggggccctggtaactgtaggggccttttttgctagcaagtga
>gnl|bcl2dbcds|G3ULB7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Loxodonta africana GN=BCL-2 (length=690 residues).
atggcgcacgcagggagaacaggttatgacaaccgggagatagtgatgaagtatatccactataagctgtcgcagcgggg
ctacgaatgggaggctggcgaagctagcgccgcgccccccggggccgctcccgcgccgggcgtcctctcttctccgcccg
cggcgccccggggcccggacaccaggacctcgccgctccaggctgacccggccgcgcagccggcgctcagcccggtgcca
cctgtagttcacctgaccttgcgccaggccggcgacgacttctccaggcgctaccgccgcgacttcgccgagatgtcgag
ccagctgcacctgactcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttcagggacggggtgaact
gggggcggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacaacatcgccctctggatgactgagtacctgaaccggcacctgcacacctggatccaggataacggaggatgggatgc
ctttgtggaactgtatggccccaacatgcgacctctgtttgatttctcctggctgtctctgaagacactgctcagtctgg
ccctggtgggagcttgcatcaccctgggtgcttacctggggcacaagtga
>gnl|bcl2dbcds|G3ULB7_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Loxodonta africana GN=BCL-2 (length=504 residues).
atggcgcacgcagggagaacaggttatgacaaccgggagatagtgatgaagtatatccactataagctgtcgcagcgggg
ctacgaatgggaggctggcgaagctgacaccaggacctcgccgctccaggctgacccggccgcgcagccggcgctcagcc
cggtgccacctgtagttcacctgaccttgcgccaggccggcgacgacttctccaggcgctaccgccgcgacttcgccgag
atgtcgagccagctgcacctgactcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttcagggacgg
ggtgaactgggggcggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgc
ccctggtggacaacatcgccctctggatgactgagtacctgaaccggcacctgcacacctggatccaggataacggagga
tgggtaggtgcatgtgtggttgaa
>gnl|bcl2dbcds|A0A2K5TKG9_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L10 (length=585 residues).
atggctgacccgttgcgggagcgcaccgagcggctcctggccgactatctggggtgctgcgcccgggaacccggcacccc
tgagccaaggccgtccacgcccgaggccgccgtgctgcgctccgcggccgccaggttacggcagctccaccggtccttct
tctccgcctaccgcggctaccccgggaaccgcgtcgagctggtggcgctgatggcggaggccgtgctctccgacagcccc
ggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgctggtgacagcctg
gtggaagaagcggggcttccagccgcggctgaaggagcaggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcagggcggctgggatggcttttgtcacttcttc
aggagcccctttccgctggctttttggagaaaactgctgatccaggctttcctggcatgcttgttagcaacagccttcgg
ttatctctggacacgattattatga
>gnl|bcl2dbcds|A0A2K5TMD8_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtacgttctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctatctctcctgaagcaatactgttga
>gnl|bcl2dbcds|A0A2K5TMD8_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2A1 (length=489 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtacgttctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggggaaatggcacaatcacatgcctatgctagtagagtcagtggcccacaagaagaaaatg
gctttgtaa
>gnl|bcl2dbcds|A0A2K5UDI5_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Macaca fascicularis GN=BCL-2 (length=729 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggcgcggcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgccgccgccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgactt
ctcccgccgctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttg
ccacggtggtggaggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatg
tgtgtggagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggca
cctgcacacctggatccaggataacggaggctgggacgcctttgtggaactgtacggccccagcatgcggcctctgtttg
atttctcctggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggc
cacaagtga
>gnl|bcl2dbcds|A0A2K5V0Q3_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
ggatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
gcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctacc
gcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A2K5V0Q3_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A2K5VPG2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5VPG2_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5W0W9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca fascicularis GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgcgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgagccccgcgaggctgcttttctttgcgcccacccgccgcgcggggcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2K5W0W9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca fascicularis GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgcgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgagccccgcgaggctgcttttctttgcgcccacccgccgcgcggggcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2K5W0W9_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca fascicularis GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgcgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|I7G687_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca fascicularis GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcagcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgagccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgtttttagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|I7GKS6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L1 (length=447 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctggcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtc
gcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcgg
atcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgt
ggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatga
ctgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|Q2PFS6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L1 (length=570 residues).
atggagacccccagtgccatcaatggcaacccatcctggcacctggtggacagccccgcggtgaatggagccactggcca
cagcagcagtttggatgcccgggaggtgatccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttg
aactgcggtaccggcgggcgttcagtgacctgacatcccagctccacatcaccccagggacagcatatcagagctttgaa
caagtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtg
cgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacc
tagagccttggatccaggagaacggcggctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccga
aagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcag
tcggaaatga
>gnl|bcl2dbcds|A0A1D5QRF2_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Macaca mulatta GN=BCL-2 (length=750 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggcgcggcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgccgccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctc
ccgccgctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgcca
cggtggtggaggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgt
gtggagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacct
gcacacctggatccaggataacggaggctgggtaggtgcacttggtgatgtgagtctgggctggggccacaggttcgagg
tgcgggggttggagtgcgggtgggctcctggggcaaggggaggctgtggagccggcgaaataaaatcagggttgttgctt
cccggcgtccctacctcttcctctggataa
>gnl|bcl2dbcds|F6UKR4_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|F6UKR4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|F7E8V5_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Macaca mulatta GN=BCL2A1 (length=471 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtacgttctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggggaaatggcacaatcacatgcctatgctagtagagtcagtggcccactag
>gnl|bcl2dbcds|F7E8V5_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Macaca mulatta GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtacgttctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctatctctcctgaagcaatactgttga
>gnl|bcl2dbcds|F7G4L5_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L2 (length=1167 residues).
atgccccttctgattctctctccatatattcatgccagtgtttcatccttgcctcttatagctgcccggatggcgacccc
agcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggttatgtctgtggag
ctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttc
cggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtctccga
tgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
tcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggctggctgactgg
atccacagcagtgggggctggttatcccagatcactgaagctgagatggctgatgaagtaatttgcagtgaaattttaag
cgactgtgactctgctccaagttccccagatctcgaggagctggaagctatcaaagctcgagtcagggagatggaggaag
aagctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggccca
gtgatcatgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagc
agaagagctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatc
ctaaaggatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttaga
ggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccg
ctaccgcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtg
tctacaggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|F7G4L5_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|F7G4L5_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|F7G4L5_BCL2L2-05 BCL2-like 2 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcctaaa
ggatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
gcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctacc
gcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|F7H6U5_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L10 (length=585 residues).
atggctgacccgttgcgggagcgcaccgagcggctcctggccgactatctggggtgctgcgcccgggaacccggcacccc
tgagccaaggccgtccacgcccgaggccgccgtgctgcgctccgcggccgccaggttacggcagctccaccggtccttct
tctccgcctaccgcggctaccccgggaaccgcgtcgagctggtggcgctgatggcggaggccgtgctctccgacagcccc
ggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgctggtgacagcctg
gtggaagaagcggggcttccagccgcggctgaaggagcaggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcagggcggctgggatggcttttgtcacttcttc
aggagcccctttccgctggctttttggagaaaactgctgatccaggctttcctggcatgcttgttagcaacagccttcgg
ttatctctggacacgattattatga
>gnl|bcl2dbcds|F7HUE9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca mulatta GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgagccccgcgaggctgcttttctttgcgcccacccgccgcgcgtcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|F7HUE9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca mulatta GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K6B2D9_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Macaca nemestrina GN=BCL2L10 (length=585 residues).
atggctgacccgttgcgggagcgcaccgagcggctcctggccgactatctggggtgctgcgcccgggaacccggcacccc
tgagccaagaccgtccacgcccgaggccgccgtgctgcgctccgcggccgccaggttacggcagctccaccggtccttct
tctccgcctaccgcggctaccccgggaaccgcgtcgagctggtggcgctgatggcggaggccgtgctctccgacagcccc
ggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgctggtgacagcctg
gtggaagaagcggggcttccagccgcggctgaaggagcaggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcagggcggctgggatggcttttgtcacttcttc
aggagcccctttccgctggctttttggagaaaactgctgatccaggctttcctggcatgcttgttagcaacagccttcgg
ttatctctggacacgattattatga
>gnl|bcl2dbcds|A0A2K6CIX3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Macaca nemestrina GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggcgcggcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggacgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A2K6DS80_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Macaca nemestrina GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtacgttctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctctctcttctgaagcaatactgttga
>gnl|bcl2dbcds|A0A2K6DS80_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Macaca nemestrina GN=BCL2A1 (length=492 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtacgttctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggggaaatggcacaatcacatgcctatgctagtagagtcagtggcccacaagaagaagaaa
atggctttgtaa
>gnl|bcl2dbcds|A0A2K6EA73_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Macaca nemestrina GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A2K6EA73_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Macaca nemestrina GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
ggatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
gcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctacc
gcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A2K6ECR0_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca nemestrina GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgagccccgcgaggctgcttttctttgcgcccacccgccgcgcggggcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2K6ECR0_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca nemestrina GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K6ECR0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca nemestrina GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgagccccgcgaggctgcttttctttgcgcccacccgccgcgcggggcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2K5XRD4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggcgcggcgacccctggggtcgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccactgccgaccccggctgcccccgccgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggacgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A2K5XSC7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgacccccgcgaggctgtttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2K5XSC7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgacccccgcgaggctgtttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2K5XSC7_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K5YR37_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5YR37_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5YR37_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L1 (length=513 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggacacttttgtggaactctatggga
acaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccggcgtg
gttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K6AD55_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2A1 (length=492 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtatgttctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacactggagaatgga
taaggcaaaacggaggctgggggaaatggcacaatcacatgcctatgctagtagagtcagtggcccacaggaagaagaaa
atggctttgtaa
>gnl|bcl2dbcds|A0A2K6AD55_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtatgttctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacactggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctctctctcctgaagcaatactgttga
>gnl|bcl2dbcds|A0A2K6AI30_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A2K6AI30_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
ggatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
gcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctacc
gcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|G1MPY7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Meleagris gallopavo GN=MCL-1 (length=369 residues).
ttttcaggaatgcttcggaagctggaaatcaaaaaagaagaagatctgcaggcggtgtgtgaggtggctgctcacgtttt
cagtgatggagtaacaaactggggccgagttgtcacactcatctcatttggtgccttcgttgcaaaacacctgaaaagca
tcaaccaagagaaatgcatcagctcgctggcggggatcatcacagacgctttggtctcatccaagcgcgagtggctgatg
agccagggaggctgggagggctttgtcgacttcttccgagttgaggacctggaaagcagcatcaggaatgtgctgatggc
ctttgcaggagtggccggcctgggggcgagcttggcctacatgatccgg
>gnl|bcl2dbcds|G1MZW1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Meleagris gallopavo GN=BCL-2 (length=318 residues).
gtggaggagcttttccgtgatggggtcaattggggccggatcgtcgccttctttgagttcggcggcgtgatgtgcgtcga
gagcgtcaaccgggagatgtcgccgctggtggacaacattgccacctggatgaccgaatacctgaacaggcacctgcaca
actggatccaggacaacggaggatgggatgccttcgtggaattgtacggcaccagtatgaggcctttgtttgatttctcc
tggatctctctgaagaccatcctgagcctggttctggtgggagcttgcatcactcttggcgcttatcttggacataag
>gnl|bcl2dbcds|G1N5N5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Meleagris gallopavo GN=BCL2L1 (length=690 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcgcagaaggggcactgctggagcgagct
ggaggaagaggatgagaacaggactgacactgcagcagaggcagagatggacagcgtcctcaatgggagcccatcctggc
acccgcctgccggccacgtagtgaatggagccgccgtgcacaggagcagcctggaagttcatgaaattgttcgagcatct
gacgtgaggcagacgctgagagatgcaggggatgagtttgagctgaggtaccggagggctttcagcgatctcacctccca
gctccacatcacccctggcacggcgtaccagagctttgagcaggtagtgaacgaactcttccatgatggtgtgaactggg
ggcgcatcgtggctttcttctccttcggaggggctttgtgcgtggagagcgtggacaaggagatgcgggtactggtggga
cgcattgtgtcttggatgaccacgtacttgaccgaccatctagacccctggatccaggagaatggcggctgggagcgctt
tgtggacctgtatgggaataatgctgctgccgagctgaggaagggccaggagaccttcaacaaatggctcctgaccgggg
cgaccgtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|G1N8C5_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Meleagris gallopavo GN=BCL2A1 (length=525 residues).
atggaaactgctgagttctattatgtttattatttagctcaagattatctgcaatatgtccttcaggaatcacgtcttgg
accagcccaaaccagagttgctcatgtcttgcgaaatattgcatcctcactccaagatcagacagaggaggcactcagac
ccttcttggacaggatcgatatcacctctgtagatgttgccaagagaattttcaatggagtcatggaagaaaaatttgct
gacggaaatactaactggggacgaattatgaccatatttacttttggaggtcttctcaccaagaagcttcaagagcaggg
agttcagctcactggagaggagaaggagcagatttcttatttcatcacagagtacatcataaataacaaagccgcatgga
tagatgcaaacggtggctgggaaaatggtttcctaacaaagtttgaaagaagatcaccactatctttctctacaattaca
gacatatttgcagctgttttttccttgttcagagactactactga
>gnl|bcl2dbcds|A0A1U7QU73_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mesocricetus auratus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctagtggttgactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaacaggactgaggccccagaaggagccgaatcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcacgggaggtg
atccccatggcagccgtgaagcaagcgctgagagaggccggcgatgagtttgaactgcggtaccggcgggcattcagtga
tctgacatcccagcttcatataaccccgggaactgcatatcaaagctttgagcaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggtggagccctctgtgtggaaagcgtagacaaggagatgcag
gtgttggtgagtcggattgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggacaacggcgg
ctgggacactttcgtggaactctatgggaacaatgcagcagctgagagccggaaaggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctctctcttcagtcggaagtga
>gnl|bcl2dbcds|A0A1U7QVA0_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Mesocricetus auratus GN=BCL2L10 (length=549 residues).
atggccgacccgctgcgggtccgcactagactgctgctaactgactacttgacgttctgtgcacgggagccgggtgaccc
cgagccaccgcccacgtcggcagaggcggccttgctgcgctctgtggcagagcagatccaacagcagcaccacttttttt
tctcctccttcgtcggctaccagggcaaccgcgtggagctgatgacacagatggtagacgccgtgctccccgatggccaa
gacctcaactggggccgcctggtgttgctcttagcctttgcggggacaattgtgagtcaagagcagagaaaccgtctgaa
ggataaaatgaaagtgctccaagactgccaactcatagtggccttgctgtgcaatcgactcctgaggcggcatcgctcct
ggctggaggctcaaggtggctgggatggcttttgtgtcatctttgggagtcccttaccactcgatttttggagcacactg
ctgatcaagacttttctgtcctgtgtcattgcaacagccatcctgtttgtctggaaaagactattataa
>gnl|bcl2dbcds|A0A1U7RC37_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Mesocricetus auratus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggctgactttgtaggctataagctgaggcagaagggcta
tgtctgtggagctggccctggggagggcccagcagccgacccgctgcaccaagccatgcgggctgctggagacgagtttg
agacccgcttccggcgcaccttctccgacctggctgctcagctccacgtgaccccaggctcagcccagcaacgcttcacc
caggtttccgacgaacttttccaagggggccccaattggggccgtcttgtggcattctttgtctttggggccgccctatg
tgctgaaagtgtcaacaaagaaatggagccacttgtgggacaagtgcaggattggatggtgacttacctggagacacgcc
tggctgactggatccacagcagtggcggctgggcggagttcacagctctgtacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A1U7RC37_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Mesocricetus auratus GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggctgactttgtaggctataagctgaggcagaagggcta
tgtctgtggagctggccctggggagggcccagcagccgacccgctgcaccaagccatgcgggctgctggagacgagtttg
agacccgcttccggcgcaccttctccgacctggctgctcagctccacgtgaccccaggctcagcccagcaacgcttcacc
caggtttccgacgaacttttccaagggggccccaattggggccgtcttgtggcattctttgtctttggggccgccctatg
tgctgaaagtgtcaacaaagaaatggagccacttgtgggacaagtgcaggattggatggtgacttacctggagacacgcc
tggctgactggatccacagcagtggcggctgggagctagaagcgatcaaagcccgagtcagggagatggaggaggaggct
gagaagctaaaggagctacaaaacgaggtagagaagcagatgaatatgagtccacccccaggcaatgctggcccagtgat
catgtctcttgaggagaagatggaggctgatgcccgttctatctatgttggcaatgtggactatggtgcgacagcagaag
agctggaagcccactttcatggctgtggttcagtcaaccgtgtcactatactctgtgacaaatttagcggccatcctaaa
gggtttgcatatatagagttctcagacaaagagtcggtgaggacttccctggccttagacgagtccctgtttagaggaag
acaaatcaaggtgattcccaaacggaccaacagaccaggcatcagtacaacagaccggggtttcccgcgtgcccgatacc
gtgcccggactaccaattacaacagctcccgatctcgattctacagcggttttaacagcaggccccggggtcgagtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|F6SFL4_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Monodelphis domestica GN=BCL2A1 (length=519 residues).
atggatgattacgagttccattatgttcacatgttagctcgggactacttgaagcatgttcaacagacaccaccactggg
atcatgtctaaataagacatctcaaatactacaaaaggttgctttctctgtccaacaagaagtagaaaaggatatggaaa
catgcttgagcactttggacatcgtttctgtagagtctgccagaagaattttcaatagtgttatgaagaaggaatttgag
gatggcgtcattaactggggacggattgtcaccatatttgcttttgggggaattctcatcaagaagcttctgagacatag
agctccactgactatgggcactcaggaagaaatttctcattttattgccgagttcataatgaacaatatagcagagtgga
taagacaaaatggaggatgggaaaatggctttgtaaagaactttgaacctaatacagtgtggccgaacttcacagatatt
tcaacaaagatctggggcatattttcctttctgaagtaa
>gnl|bcl2dbcds|F6U940_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Monodelphis domestica GN=BCL2L2 (length=582 residues).
atggcgactccagcctcagccccagatactcgagccctggtggcagattttgtgggttacaagctgaggcagaagggcta
tgcctgtggaactggcccaggagagggccctacaacagagcccttgcaccgggccatgcgtgctgctggagacgagtttg
agtcccgctttcgacgcacattttctgatctggccgctcagttgcatgtgactcctggctcggctcagcagcgctttacc
caggtctcagatgagctcttccaaggggggcccaactggggccgtcttgtggcattcttcgtctttggggcagcgctctg
tgcagagagtgtcaacaaagagatggagccactggtgggacaggtgcaggactggatggtgacctacctagagacacagc
tggcagactggatccacagcagtgggggctgggcggaattcacggctctgtacggggatggggccctggaggaggcaagg
cgtctgcgggaggggaactgggcctcagtgcgaacagtgctaacaggggctgtagcactgggggctctggtgactgtggg
ggccttctttgccagcaagtga
>gnl|bcl2dbcds|F6VJQ0_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Monodelphis domestica GN=BCL2L10 (length=570 residues).
atggattacaagtgtgctcttagggaagagacggcgcggctggtaactgactacctggaatattgttgccggagggaagg
cgtccaggagctgccggcccctacccctgctgcagctacactgcgtttggtgtcgagcgagctccgccagatttaccagg
acttcttcgagtgcgccctgaatcagctactcgaccgggaacctgagcaagtaatcgtcaacgtagcggagctcatggac
cgaggcgagttcaactggggccgggtggcggtgctagtggtttttgccggggcgctgctggagatggaggaactactgaa
agaggagcaggtactgcagcttcggagggaaacgagccggcgtctgaccgaaaaactctgcaactatctggtggagagga
agggcgcgtggctgcatgagaacggaggctggactggctttcaccaccacttcgaaaaaaggcaatctcctccaccaagt
gactcaagtaataatacactgtgctgcataatggcagcagcagcaggatttggactagtgggattagctcttttattagt
cgtacgataa
>gnl|bcl2dbcds|F6WA14_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Monodelphis domestica GN=BCL2L1 (length=684 residues).
atgtcgcacagtaaccgggagctggtgattgactttctttcttacaagctctcacagaaaggatacaattggagtcagtt
tgaagatgagaacaggactgaggttctagaaggggcagagatacctagtactgtgaatggcagtccctcttggcaccctg
ctgacagccgtgctgtgagtggggccacagggcacagcagcagcctggatgcccatgagacaataccagtggctgctgtg
aagcaagctttgagggaggcaggagatgaatttgaacttcggtacaggcgggcattcagtgacctgacatcccagctcca
catcacgccaggaacagcttatcagagctttgagcaggtagtgaatgaactcttccgggatggggtgaactggggccgaa
ttgtggcattcttctccttcggaggggcattgtgtgtggaaagcgtggataaggagatggaagtcttggtaggacgcatc
acctcctggatggccacttacttggatgaccacctagacccttggatccaagaaaatggcggctgggacacctttgtgga
actttatgggaatgatgcagctgcagagagccggaagggccaggaacgcttcaaccgatggctgctgactggcatgacag
tggccggtgtagtcctgctggggtccctattcagccggaagtga
>gnl|bcl2dbcds|F6YNL8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Monodelphis domestica GN=BCL-2 (length=771 residues).
atgatggctcaccctggaagaagaggatatgataaccgggagatagtgatgaaatacattcattataaactgtcacagag
ggggtacgagtgggatgctggagatctgagggcaccagcctctccaagtcttcctcctgttgttgcttctgcccctgctg
ttggaatcttctctacccagccacgaaacacaccattgcctgctgaaccccaggactcggccacttctactactgctgct
gctagaaactcacctttgcctcttcctcctcctgctgttgctgctgctgctgctgctggacctaccgtcagtccagtgcc
acctgtggtccacctgactcttcgtcaagctggagatgatttctctagaaggtaccggagagactttgatgaaatgtcag
gtcaactgcacctgacccctgttactgctaggggacgctttgccacagtggtagaggagctgttcagggatggggtgaac
tgggggaggatcgtggccttctttgagtttggtggtgttatgtgtgtggagagcgtcaaccgggagatgtcgcccctggt
ggacagcattgccctatggatgactgagtacctgaaccggcacctgcacacttggatccaggataacggaggatgggatg
cctttgtggaattgtatggcaacagcatgaggcctttgttcgatttctcctggctgtctctgaagactcttctcagcctg
gctctggtgggagcttgtgtcactcttggtgcctacctgggacacaaatga
>gnl|bcl2dbcds|F6ZMX1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Monodelphis domestica GN=MCL-1 (length=1068 residues).
atgttaggccctttcaagaagaacgccgtcatcggcctcaacctttactgtggcggggcagggatgggcgccggcggcgg
cgccagcggtcccccgtccggcgggcgcctgctagcttctggcaaaggccctacggttgagagtactccgccgcagcgcg
atggaggggaagtggaaacagggacggcgggggcagggttgattggcggaggaatccgtgcgagtcctccgaatcctgtc
tcgccgggcgcccggggggtcgcgcggcccgcacccattggcgcggaggcccccgacgtcaccaccgatccgatgccgag
cctgttcgcgccgggccgctgctcgtcggcgcccgccgaggtggccgatggggctgcggacgtcccaatgtgccctgagg
aggaactggacggttacgagcccgagcctcccgggaagcggccctcccgcctggctgtgctggaaatagcccgggaaggt
ggggacagcccgaacggctctttgccttcgacgccgcccccagctgaggaggatgaagaagaggatgaactatacgggca
gtccttggagctcatcagccggtaccttcgcgagcaggcggttggcacgaaggaggccaagcccctacgcagcggcaagg
ccttagagaccctgcgacgcgtgggagacggtgtccagaggaaccacgagagggctttccaaggcatgcttcggaaattg
gatatcaaaaacgaagaggatattaaagctgtgtctcgagtggcgacccatgttttcagtgacggtataacaaactgggg
caggattgtgactctcatttctttcggtgcctttgtggcaaagcacttgaagagcataaaccaggaaagttgcatagacc
cgctagcagaaagcataacagatgttctggtcaagacaaaacgggactggctgattaagcaaaagggctgggagggattt
gtggaattctttcatgtacaggacctagaaggtggcatcagaaatgtgctgctcgcctttgccggtgttgctggagtagg
agctggtttggcatatctaataagatag
>gnl|bcl2dbcds|D3Z5F7_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Mus musculus GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcaaccccagacacacgggctctagtggctgactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggccctggggaaggcccagccgccgacccgctgcaccaagccatgcgggctgctggagacgagtttg
agacccgtttccgccgcaccttctctgacctggccgctcagctacacgtgaccccaggctcagcccagcaacgcttcacc
caggtttccgacgaacttttccaagggggccctaactggggccgtcttgtggcattctttgtctttggggctgccctgtg
tgctgagagtgtcaacaaagaaatggagcctttggtgggacaagtgcaggattggatggtggcctacctggagacacgtc
tggctgactggatccacagcagtgggggctgggagctagaagcgatcaaagctcgagtcagggagatggaggaagaggct
gagaagctaaaggagctacaaaacgaggtagagaagcagatgaatatgagtccacccccaggcaatgctggcccagtgat
catgtctcttgaggagaagatggaggctgatgcccgctctatctacgttggcaatgtggactatggtgcaacagcagaag
agctggaagcccattttcatggctgtggttcagtcaaccgtgttactatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcggacaaagagtcagtgaggacgtccctggccttagatgagtccctgttcagaggaag
acaaatcaaggtgattcccaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccgcgctcccgatacc
gtgcccggactaccaactacaacagctcccgatctcgattctacagtggttttaacagcaggccccggggtcgaatctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|O35843_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mus musculus GN=BCL2L1 (length=708 residues).
atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgttgaagagaataggactgaggccccagaagaaactgaagcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagcccggccgtgaatggagccactggccacagcagcagtttggatgcgcgggaggtg
attcccatggcagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcggtaccggagagcgttcagtga
tctaacatcccagcttcacataaccccagggaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctatctgaatgaccacctagagccttggatccaggagaacggcgg
ctggggtgtgagtggaggtacacccctcagatctgtcttcagaaggcttgttcaagtgccaggagtggcggagcacgttt
gtgatcccagcctttgggaggtggaaacagaaggatcggaagttcaaggccctcctcagctattatag
>gnl|bcl2dbcds|O55177_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Mus musculus GN=BCL2A1 (length=519 residues).
atggctgagtacgagttcatgtatatccactccctggctgagcactatcttcagtatgtgctacaggtacccgcctttga
gtcggctccaagccaagcatgcagagtgctacaaagagttgctttctccgttcagaaggaagttgaaaagaatctgaagt
catacttggatgactttcacgtggaatccatagataccgccagaataatattcaaccaagtgatggaaaaagagtttgaa
gatggcatcattaactggggaaggattgtgactatatttgcctttgggggtgttctcctcaaaaaacttccgcaagagca
gattgccctggatgtaggtgcttacaaacaagtttccagttttgtggcagaattcataatcaataacacaggagaatgga
tacggcggaatggaggttgggaagatggcttcataaagaagtttgaacccaaatctggctggctgacttttctgcagatg
acaggacagttctgggaaatgctctttctcctcaagtaa
>gnl|bcl2dbcds|O55178_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Mus musculus GN=BCL2A1 (length=387 residues).
atggctgagtacgagctcatgcatatccactccctggctgagcactaccttcagtatgtgctacaggtacccgcctttga
gtcggctccaagccaagcattcagagtgctacaaagagttgctttctccgttcagaaggaagttggaaagaacctaaagt
catacttggatgactttcacgtggaatccatagataccaccagaataatattcaaccaagtgatggaaaaagagtttgaa
gatggcatcattaattggggaaggattgtgactatatttgcctttgggggtgttctcctcaaaaaaacttccacaagagc
agattgccctggatgtacgtgcttacaaacaagtttccagttttggggcagaattcataatgaataa
>gnl|bcl2dbcds|O55179_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Mus musculus GN=BCL2A1 (length=519 residues).
atgtctgagtacgagttcatgtatatccactccctggctgagcactaccttcagtatgtgctacaggtacccgcctttga
gtcggctccaagccaagcatgcagagtgctacaaagagttgctttctccgttcagaaggaagttgaaaagaatctgaagt
catacttggatgactttcacgtggaatccatagataccgccagaataatattcaaccaagtgatggaaaaagagtttgaa
gatggcatcattaactggggaaggattgtgactatatttgcctttgggggtgttctcctcaaaaaacttccacaagagca
gattgccctggatgtaggtgcttacaaacaagtttccagttttgtggcagaattcataatgaataacacaggagaatgga
tacggcggaatggaggttgggaagatggcttcataaagaagtttgaacccaaatctggctggctgacttttctgcagatg
acaggacagatctgggaaatgctctttctcctcaagtaa
>gnl|bcl2dbcds|P10417_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mus musculus GN=BCL-2 (length=600 residues).
atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatacattataagctgtcacagagggg
ctacgagtgggatgctggagatgcggacgcggcgcccctgggggctgcccccacccctggcatcttctccttccagcctg
agagcaacccaatgcccgctgtgcaccgggacatggctgccaggacgtctcctctcaggcccctcgttgccaccgctggg
cctgcgctcagccctgtgccacctgtggtccatctgaccctccgccgggctggggatgacttctctcgtcgctaccgtcg
tgacttcgcagagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggaac
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcacccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggataacggaggctgggtaggtgcatgtctggttgaatga
>gnl|bcl2dbcds|P10417_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mus musculus GN=BCL-2 (length=711 residues).
atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatacattataagctgtcacagagggg
ctacgagtgggatgctggagatgcggacgcggcgcccctgggggctgcccccacccctggcatcttctccttccagcctg
agagcaacccaatgcccgctgtgcaccgggacatggctgccaggacgtctcctctcaggcccctcgttgccaccgctggg
cctgcgctcagccctgtgccacctgtggtccatctgaccctccgccgggctggggatgacttctctcgtcgctaccgtcg
tgacttcgcagagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggaac
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcacccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggataacggaggctgggatgcctttgtggaactatatggccccagcatgcgacctctgtttgatttctcctggctgtctc
tgaagaccctgctcagcctggccctggtcggggcctgcatcactctgggtgcatacctgggccacaagtga
>gnl|bcl2dbcds|P70345_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Mus musculus GN=BCL2L2 (length=537 residues).
atggcgaccccagcctcaaccccagacacacgggctctagtggctgactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggccctggggaaggcccagccgccgacccgctgcaccaagccatgcgggctgctggagacgagtttg
agacccgtttccgccgcaccttctctgacctggccgctcagctacacgtgaccccaggctcagcccagcaacgcttcacc
caggtttccgacgaacttttccaagggggccctaactggggccgtcttgtggcattctttgtctttggggctgccctgtg
tgctgagagtgtcaacaaagaaatggagcctttggtgggacaagtgcaggattggatggtggcctacctggagacacgtc
tggctgactggatccacagcagtgggggctgggtaagaagttctcaattgctgctctccgcatccctctacaaagttggt
cttcatgggaaaatagggcctctgatgggaggctggggttgtgctgggaagggctga
>gnl|bcl2dbcds|P70345_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Mus musculus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcaaccccagacacacgggctctagtggctgactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggccctggggaaggcccagccgccgacccgctgcaccaagccatgcgggctgctggagacgagtttg
agacccgtttccgccgcaccttctctgacctggccgctcagctacacgtgaccccaggctcagcccagcaacgcttcacc
caggtttccgacgaacttttccaagggggccctaactggggccgtcttgtggcattctttgtctttggggctgccctgtg
tgctgagagtgtcaacaaagaaatggagcctttggtgggacaagtgcaggattggatggtggcctacctggagacacgtc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcacgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|P70345_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Mus musculus GN=BCL2L2 (length=240 residues).
atggagcctttggtgggacaagtgcaggattggatggtggcctacctggagacacgtctggctgactggatccacagcag
tgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcacggcgtctgcgggaggggaactggg
catcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtaggggccttttttgctagcaagtga
>gnl|bcl2dbcds|P97287_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mus musculus GN=MCL-1 (length=858 residues).
atgtttggcctgcggagaaacgcggtcatcggcttgaacctgtactgcggcggcgccgaggaccccgacgtcaccgcgtc
ggccgaaaggcggctgcataagtcgcccggcctcctcgccgtgccgcccgaggagatggccgcgtcggccgccgccgcca
tcgtgtctccggaggaggaactggacggctgcgagccggaggccatcggcaagcgcccggccgtgctgcccctcctggag
cgcgtgagcgaggcggccaagagctccggggccgacggctctctgccctccacgccgccgccgcccgaggaggaagagga
cgacctataccgccagtcgctggagatcatctcgcgctacttgcgggagcaggcgaccggctccaaggactcgaagcctc
tgggcgaggcgggcgcggcgggccggagagcgctggagaccctgcggcgcgtgggcgacggcgtgcagcgcaaccacgag
acggccttccagggcatgctccggaaactggacattaaaaacgaaggcgatgttaaatctttttctcgagtaatggtcca
tgttttcaaagatggcgtaacaaactggggcaggattgtgactcttatttctttcggtgcctttgtggccaaacacttaa
agagcgtaaaccaagaaagcttcatcgaaccattagcagaaactatcacagatgttcttgtaaggacgaaacgggactgg
cttgtcaaacaaagaggctgggatgggtttgtggagttcttccacgtacaggacctagaaggcggcatcagaaatgtgct
gctggcttttgcgggtgttgctggagtaggggctggtctggcatatctaataagatag
>gnl|bcl2dbcds|P97287_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mus musculus GN=MCL-1 (length=996 residues).
atgtttggcctgcggagaaacgcggtcatcggcttgaacctgtactgcggcggcgccagcctcggcgcgggcggcggttc
tccggcaggggcgcgcctggtggccgaggaggccaaggcgcggcgcgaggggggaggggaggccgccctgctgcccggcg
cgcgggtggtcgcccggccgccgcccgtgggcgccgaggaccccgacgtcaccgcgtcggccgaaaggcggctgcataag
tcgcccggcctcctcgccgtgccgcccgaggagatggccgcgtcggccgccgccgccatcgtgtctccggaggaggaact
ggacggctgcgagccggaggccatcggcaagcgcccggccgtgctgcccctcctggagcgcgtgagcgaggcggccaaga
gctccggggccgacggctctctgccctccacgccgccgccgcccgaggaggaagaggacgacctataccgccagtcgctg
gagatcatctcgcgctacttgcgggagcaggcgaccggctccaaggactcgaagcctctgggcgaggcgggcgcggcggg
ccggagagcgctggagaccctgcggcgcgtgggcgacggcgtgcagcgcaaccacgagacggccttccagggcatgctcc
ggaaactggacattaaaaacgaaggcgatgttaaatctttttctcgagtaatggtccatgttttcaaagatggcgtaaca
aactggggcaggattgtgactcttatttctttcggtgcctttgtggccaaacacttaaagagcgtaaaccaagaaagctt
catcgaaccattagcagaaactatcacagatgttcttgtaaggacgaaacgggactggcttgtcaaacaaagaggctggg
atgggtttgtggagttcttccacgtacaggacctagaaggcggcatcagaaatgtgctgctggcttttgcgggtgttgct
ggagtaggggctggtctggcatatctaataagatag
>gnl|bcl2dbcds|Q07440_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Mus musculus GN=BCL2A1 (length=519 residues).
atggctgagtctgagctcatgcatatccactccctggctgagcactaccttcagtatgtgctacaggtacccgcctttga
gtcggctccaagccaagcatgcagagtgctacaaagagttgctttctccgttcagaaggaagttgaaaagaatctgaagt
catacttggatgactttcacgtggaatccatagataccgccagaataatattcaaccaagtgatggaaaaagagtttgaa
gatggcatcattaactggggaaggattgtgactatatttgcctttgggggtgttctcctcaaaaaacttccacaagagca
gattgccctggatgtatgtgcttacaaacaagtttccagttttgtggcagaattcataatgaataacacaggagaatgga
tacggcagaatggaggttgggaagatggcttcataaagaagtttgaacccaaatctggctggctgacttttctgcagatg
acaggacagatctgggaaatgctctttctcctcaagtaa
>gnl|bcl2dbcds|Q0P538_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Mus musculus GN=BCL2A1 (length=387 residues).
atggctgagtacgagctcatgcatatccactccctggctgagcactaccttcagtatgtgctacaggtacccgcctttga
gtcggctccaagccaagcattcagagtgctacaaagagttgctttctccgttcagaaggaagttggaaagaacctaaagt
catacttggatgactttcacgtggaatccatagataccaccagaataatattcaaccaagtgatggaaaaagagtttgaa
aatggcatcattaattggggaaggattgtgactatatttgcctttgggggtgttctcctcaaaaaaacttccacaagagc
agattgccctggatgtacgtgcttacaaacaagtttccagttttggggcagaattcatcatgaataa
>gnl|bcl2dbcds|Q497M6_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Mus musculus GN=BCL2A1 (length=519 residues).
atggctgagtacgagttcatgtatatccactccctggctgagcactatcttcagtatgtgctacaggtacccgcctttga
gtcggctccaagcaaagcatgcagagtgctacaaagagttgctttctccgttcagaaggaagttgaaaagaatctgaagt
catacttggatgactttcacgtggaatccatagataccgccagaataatattcaaccaagtgatggaaaaagagtttgaa
gatggcatcattaactggggaaggattgtgactatatttgcctttgggggtgttctcctcaaaaaacttccgcaagagca
gattgccctggatgtaggtgcttacaaacaagtttccagttttgtggcagaattcataatcaataacacaggagaatgga
tacggcggaatggaggttgggaagatggcttcataaagaagtttgaacccaaatctggctggctgacttttctgcagatg
acaggacagttctgggaaatgctctttctcctcaagtaa
>gnl|bcl2dbcds|Q4FK02_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Mus musculus GN=BCL2A1 (length=519 residues).
atgtctgagtacgagttcatgtatatccactccctggctgagcactatcttcagtatgtgctacaggtacccgcctttga
gtcggctccaagcaaagcatgcagagtgctacaaagagttgctttctccgttcagaaggaagttgaaaagaatctgaagt
catacttggatgactttcacgtggaatccatagataccgccagaataatattcaaccaagtgatggaaaaagagtttgaa
gatggcatcattaactggggaaggattgtgactatatttgcctttgggggtgttctcctcaaaaaacttccgcaagagca
gattgccctggatgtaggtgcttacaaacaagtttccagttttgtggcagaattcataatcaataacacaggagaatgga
tacggcggaatggaggttgggaagatggcttcataaagaagtttgaacccaaatctggctggctgacttttctgcagatg
acaggacagttctgggaaatgctctttctcctcaagtag
>gnl|bcl2dbcds|Q8K164_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Mus musculus GN=BCL2A1 (length=519 residues).
atggctgagtacgagttcatgtatatccactccctggctgagcactatcttcagtatgtgctacaggtacccgcctttga
gtcggctccaagccaagcatgcagagtgctacaaagagttgctttctccgttcagaaggaagttgaaaagaatctgaagt
catacttggatgactttcacgtggaatccatagataccgccagaataatattcaaccaagtgatggaaaaagagtttgaa
gatggcatcattaactggggaaggattgtgactatatttgcctttgggggtgttctcctcaaaaaacttccgcaagagca
gattgccctggatgtaggtgcttacaaacaagtttccagttttgtggcagaattcataatcaataacacaggagaatgga
tacggcggaatggaggttgggaagatggcttcataaagaagtttgaacccaaatctggctggctgacttttctgcagatg
acaggacagatctgggaaatgctctttctcctcaagtaa
>gnl|bcl2dbcds|Q9Z0F3_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Mus musculus GN=BCL2L10 (length=576 residues).
atggccgactcgcaggacccactgcatgaacgcactagacggctgctgtctgactacatattcttctgcgcacgggagcc
ggacaccccagagccaccgcccacgtctgtcgaggcggccttgcttcgctctgtgactaggcagatccagcaggagcacc
aagaatttttttcctccttctgcgaaagccggggcaatcgcctggagctggtgaaacagatggcagataagttgctctcc
aaagaccaagacttcagctggagccaactggtgatgctcctggccttcgcggggacgcttatgaatcaaggcccttacat
ggctgtcaagcagaagagggatctggggaatcgtgtcatagtgacccgagactgctgtctcatagtgaactttctgtata
atctgctcatggggcgtcggcaccgcgccaggctggaggctctcggcggctgggatggcttttgccgcttcttcaagaat
cctttaccgctcggcttctggagaagattgctgattcaggcttttctgtcaggcttctttgcaacagccatcttttttat
ctggaaacgtttataa
>gnl|bcl2dbcds|M3XZZ5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mustela putorius furo GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggctgggggccggcaccggggg
cgcctcctcttcgggagggcggcttttggcttcggggaaggaggccacggcccggcgggaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagtaccccggccactctcgcgccggacgcccggagggtcgcgcggccctcg
cccattggcgccgagggccccaacgtcaccgcgacccccccgaggctgctgttcttcgagcctacccaccgcgcgtcgcc
gcctgaagagatggaaggcccagctgccgacgccatcatgtcgcccgaagaggagctggatgggtacgagccggaacctt
tggggaagaggcctgctgtcctgcctttgctggagttggtgggggaggccagcagtggcccctgcacggacggctcactg
ccctcgacgccacccccagcagaggaggaggaagacgagttgtaccggcagtctctggagattatttctcggtacctgcg
ggagcaggcaacgggcgccaaggacgcgaaaccactgggcgggcctggggctgccagccggaaggcgttagagaccctcc
gacgggtcggggacggggtacagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtgcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|M3Y5X5_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Mustela putorius furo GN=BCL2L2 (length=660 residues).
aagcctgaagcaccccttctggctttccaaccatatattcacgccagcctttcatccttgactcttacagccgcccggat
ggcgaccccggcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggttatg
tttgtggagctggccctggggagggcccagcagctgacccactgcaccaagccatgcgggcagctggagatgagtttgag
acccgcttccggcgtaccttctctgatttggcagcccagctgcatgtgaccccaggctcggcccagcagcgcttcaccca
ggtctctgacgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcactgtgtg
ctgagagtgtcaacaaagagatggagccacttgtgggccaagtgcaagagtggatggtggcctacctggagacgcggctg
gccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcggcg
tctgcgggaggggaactgggcctcagtgaggacagtgctgacaggggccgtggcactgggggccctggtaactgtagggg
ccttttttgctagcaagtga
>gnl|bcl2dbcds|M3Y8D1_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Mustela putorius furo GN=BCL2L10 (length=681 residues).
atgggtgtggcggcccctccctgggcggaggcgcagcgggacctagaaaaccgggtcgggtcgggcagcgcggggagagg
tcgggccatggcggacgctttgagggagcgcacggcgcagctgctgaccgactacctggagtactgcgcccgcggccccg
gcacccccgcgcggtcgccgtctacgcgcgaggccgcggtgctgcgctcggtggccgccgtcgtgcggcagcgtcacgag
cgcttcttgtcggattaccgcggctacggcggcaaccgcgtcgagctggtggctcagttggagcgggagatactcgccca
cccccaagccctaagctggggccgtgtggtggcgctcgtgaccttcgcgggaacgctgctggagcgcccgccgtcggggg
cctgctcgaacttggggccggacccggaactggaactggagctgggggagtgggaggccagcgttcgccaagactgccgg
cgcctggtggacttcctctgcggtcggctcacagggcagcaccgcgcctggctggaggcgcacggcggctgggatggctt
ttgtctcttcttcacacccgcgctgctgtcttggaaaagactgctggtccaggctcttctgtcatgctttacggcagtga
tcttaatctacttctggaaaagattaccatttattgggtga
>gnl|bcl2dbcds|M3YVH4_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Mustela putorius furo GN=BCL2A1 (length=525 residues).
atgacagacagtgagttcgggtacacgctgtcgctggcccaggactacgtgaggcatgtcctgcagatcccgcagcccag
cccggccgccagcagagtgtcccgggtcctgcgggacgtggcctcctccgtgcagggggaggtggaacagaacttgagac
catgcttggacagctttgatgtggggtccatcgacactgccagaaccatcttcaatcaagtcatggaaaaggaatttgaa
gacggcatcattaactgggggaggattgtgaccgtgtttgcctttgaaggcattctctccaagaagctcctccgggagcg
aatttccccggacgtggatgcttccagggtttcttactttgtggcagagttcatcacgacaaacatgagggagtggataa
gacagaacggaggctgggaggatggctttgtaaagaagttcgagcccaagtccggctggctgacctttctggaagttata
ggaaagatctgtgaaatgttctctctcctgaagcaatactactga
>gnl|bcl2dbcds|M3YYK3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mustela putorius furo GN=BCL-2 (length=621 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
aagaccagtgatgaaactcgtgtacttacccaccgccccccccccaccccccctctcccgccaccgccgcccgcagctca
cctccccggccaccgccctcgccgccgctgccgccgcgggccctgcgctcagccccgtgccacctgtggtccacctgacc
ctgcgccaggccggcgacgacttctcccgtcgctaccgccgcgacttcgcggagatgtccagccagctgcacctgacgcc
cttcaccgcgaggggacgctttgccacggtggtggaggagctcttcagggatggggtgaactgggggaggattgtggcct
tctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctatgg
atgactgagtacctgaaccggcacttgcacacctggatccaggacaacggaggctggcctgcccccgccccccatgaagg
tccagctgccagacctattgttgatgattcctactggcccaaagtgttttccttgcttgcc
>gnl|bcl2dbcds|M3Z2H9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mustela putorius furo GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgcagaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtaaagcaagcgctgagggaggctggggatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatctcagcttcacatcaccccagggacagcgtatcagagctttgagcaggtggtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggctctgtgtgtggagagcgtagacaaggagatgcag
gcattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggacactttcgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|G1P3J2_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Myotis lucifugus GN=BCL2L2 (length=660 residues).
cctgaaatgctccattctgtgtctctgactaaatatactcatgccagtcttttatccttgacctttacagccgcccggat
ggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggctacaagctgaggcagaagggttatg
tttgtggagcgggtcccggagagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcgag
acccgtttccgtcgcaccttctctgatctggcggctcagctgcatgtgaccccgggctcagcccagcaacgcttcaccca
ggtctctgatgaactcttccaagggggccccaactggggtcgccttgtggccttctttgtctttggagctgctctgtgtg
ctgagagtgtcaacaaggagatggagccacttgtgggacaagtacaggagtggatggtggcctacctggagacgcggctg
gccgactggatccacagtagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggctcgacg
cctgcgggaggggaactgggcctcagtgaggacagtgctgacgggggccgtggcactaggggccttggtaactgtaggag
cattttttgctagcaagtga
>gnl|bcl2dbcds|G1P9D2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Myotis lucifugus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggaactggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccctgcggtgaatggagccactggccacagcagtagcttggatgcccgggaggtg
attcccatggcagcggtgaagcaagcgctgagggaggcaggcgacgagtttgaactgaggtaccggcgggcgttcagcga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgagcaagtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctcgttcggtggggcattgtgcgtggaaagtgtggacaaggagatgcag
gtattggtgagtcggattgcaacgtggatggccacttacctgaatgaccacctagagccttggatccaggagaacggagg
ctgggacacttttgtggaactctacgggaacaacgcagcagccgagagccggaagggccaggaacgcttcaatcgctggt
tcctgacgggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|G1PZ39_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Myotis lucifugus GN=MCL-1 (length=795 residues).
gccccgccctctcccattagcggccgagggccccgacgtcatcgggacccttcgcgcggcggctgtttgcgccccttggc
tgtgcggggctgcccgcggagatggaaagccgcggccgccgacgccatcatgtcgccggaagaggagctggacgggtacg
agccggagcctctcgggaagcggccggccgtcctgcccttggtgcagctggtcggggaggccagcggcggccccggcgcg
gggggctcgctgccctccacgccgccccccgcggaggaggaggaggacgagctgttccggcagtcgctggagatcatctc
tcggtaccgggagcaggcgaccggcgccaaggacgccaagcccctgggcgggcccgcggcctccagccggaaggcgctgg
agaccctgcggcgggtcggggacggcgtgcagcggaaccacgagatggccttccaaggtgagcgggggccgcgcgccctc
tgtcttgtccgcgatcgctgggctcccgtgggtggaaaccgagacgagcccgggctggaagggctctccgcccgtttccg
aaaccagcatattctggccatgagtcattgtttccgcccacccgattccttgggaaccgctctccgctcaaaggccggaa
aggtgtgggagacctccaacacttgccatggcttcaaggatgggtttgtggaattcttccatgtagaggacctagaaggc
ggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|G1Q051_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Myotis lucifugus GN=BCL2L2 (length=621 residues).
atgaatgaattttctctagacaactttatgctctatagttttgattctgttgatattaggcccaaagtgctgggtcctaa
gagctcccagcctcaggccccagacacacaggctctggtggcagactttgtaggctacaagctgaggcagaagggttatg
tttgtggagcgggtcccggagagggcccagcagctgacccactgcaccaagccatgcgggcagctggagatgagtttgag
acccatttccgatgcaccttctctgatctggtggctcagctgcatgtgaccccaggttcagcccagcaatgtttcaccca
ggtctctgatgaactcttccaggggggccccaactggggttaccttgtggccttctttgtctttggagctgctctgtgtg
ttgagagtgtcaacaaggagatggagccacttgtgggacaagtacaggagtggacggtggcctacctggagatgcggctg
gctgactggatccacagtattgggggctgggcagagttcacagctctatacgggaactgggcctcagtgaggacagtgct
gacgggggccctggcactaagggccttgttaactgtaggagcattttttgctagcatgtga
>gnl|bcl2dbcds|G1QAV8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Myotis lucifugus GN=MCL-1 (length=975 residues).
atgtttggccccaaaagaaatgcattcatcggactcaacctccactgcgggggggcagttgggggcctgtggcggcagcg
aagcctacatctccttcaggaaggaggtccctgcccccaagagtcaggggcggggagggaaacgggcacggtgattggct
ggagcgctggcgcgagcccccaagccactctcgcgagggatcctgggagggtcgctcgcccctcgcccatgggcacggag
ggtcccgatggcaccgcggcccctgccaggtggctgttctcgcccatcagccggaattgccctgaagagctgggagctct
ggcagccgacgccatcatgtcgcccggagaggagctgggcaggtatgagccggagccgaagcagccggctgtcctgccct
tgctccagctggtcggggaggccagcgaaggccccgcaggtggctcactgccctcgaccccgccccctgctgaggaggag
gaggaattgtcactgctggagatgatccctcagcaccttagggaacgggctggcgccagggaccaaagccagggcccgcg
ggtcggcggggtgcagcggcgtgcagcagggtgcagcggggtgcggcaggagactgccttcctaggtatgcttgaactgg
acaccgaaaacgaagacaacgtcaaatcttcgtctcaagcgatggttcatgcttttagggacggagtgacaaacggcagg
attgtgactcatttcttttggtgcctttgtagccacttgaagagcataaaccaagaaagctgcattgaaccgttagcaga
agacatcacagatgttctcgtagggacagaacgaggctggctagtcaaacagagaggctgggatgggtttgtggaattct
tccaggtggaggacctagaaggcggcgtcagaaatgtgctgctggcttttgcaggtgctggagtaggagctggtttgcca
tatctaataaggtag
>gnl|bcl2dbcds|G1QEX2_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Myotis lucifugus GN=BCL2L10 (length=537 residues).
gacgagttgaagttgcgcacccgacggctgctgaccgagttcctggaacaccgcacccgaaggcgcggcactgccccgca
gcagccgtccacgcccgaggccaccgtgatgcgctccctggctgctcattcgtggctgggtaccccgcactcctggtccc
ggaggcagagaaaccgactcgagcagatggtcgaccagatagagtcgctagttccagacggcacagaccccaactggttg
agcgtggtggcgctcgtgtccttcgcgggggccctgctggagagaccgccgccaggccactcgcaggcacgcagggaatg
ggatgccaccgttgaccaggactgccagcgcctggtcaccttcctgtgcagttggctcacggagacgcaccgcacctgga
tggaggcgcaaggtggctgggatggcttttgtcacaacttcatgcctgcaccgccgcctggggacagactgctggctccg
cttctgagggcatgccttgtactcataatcttaatctgcttgtggataaaaatcatg
>gnl|bcl2dbcds|R4JQR8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mytilus galloprovincialis GN=BCL2L1 (length=558 residues).
atgaaccagtttagttcaagatatttagtggcagactttattaatgaccgacttcgaaaacatggaatgcgatgggacaa
ctgtcctacgttagacttgccaccatcacaaattcagcttaaattacgttcacttggagatgaattccaagaaagatttc
agactcagtttgacgatatggtcaatcagttacacataactgaggctactgcatatccaacgtttcaaagagttgttcag
gaattatttattgatggaaatattaactggggaaggattgtggctcttttcggttttggtgggtctttgtcagtgaaatg
tgtacaaagaggaatgccacaacttgtggattcaattgttgactgggtatctacctatttgtgtaatagtttagagcaat
ggattacagataacggtggttggcaaggatttgtggaagcctataaccaaggacagaatcataatgacagtccgtgggat
gtgaaaggacttgttaaatacggagcaataggtgtaataggcgcaatggcgttaagtgcttttctacatagaacgtga
>gnl|bcl2dbcds|A0A2I3GB35_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Nomascus leucogenys GN=MCL-1 (length=444 residues).
atgtttggcctcagaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
catgcttcggaaactggacatcaaaaacgaagacgatgtcaaatcgttgtctcgagtgatggtccatgttttcagcgacg
gcgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaa
gaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaag
aggctgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcag
gtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2I3GB35_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Nomascus leucogenys GN=MCL-1 (length=1053 residues).
atgtttggcctcagaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtcagtcctcacaccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtctccgacgtcactgcgacccccgcgaggctgcttttcttcgctcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagatcatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatcgttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2I3GB35_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Nomascus leucogenys GN=MCL-1 (length=816 residues).
atgtttggcctcagaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtcagtcctcacaccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtctccgacgtcactgcgacccccgcgaggctgcttttcttcgctcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagatcatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2I3GZF9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccattataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgcccccgggggccgcccccgcaccgggcatcttctcctcccagccgg
ggcacacgccccatccagctgcatcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccggcgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgatgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A2I3HNF3_BCL2A1-03 BCL2-related protein A1 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2A1 (length=618 residues).
atgacagactgcgaatttggatatatttacaggctagctcaggactatctgcagtacgtcctacagataccacagcctgg
atcaggtccaagcaaaacgtccagagtgctacaaaacgttgcgttctcagtccaaaaagaagtggaaaagaatctgaagc
cgtgcttggacaatgttaatgttgtgtccatagacactgccagaacactattcaaccaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcgtcaagaaacttctacgacagcg
aactgccccggatgtggatacttacaaggagatttcgtattttgttgcagagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctcaatactgttgactagaaaggacactccatattgtgaaaccggcctaatttttctgactcttatgga
aacaattgccaacacatacttctactttaaaataaacaactttgatgatgtaacttga
>gnl|bcl2dbcds|A0A2I3HNF3_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2A1 (length=492 residues).
atgacagactgcgaatttggatatatttacaggctagctcaggactatctgcagtacgtcctacagataccacagcctgg
atcaggtccaagcaaaacgtccagagtgctacaaaacgttgcgttctcagtccaaaaagaagtggaaaagaatctgaagc
cgtgcttggacaatgttaatgttgtgtccatagacactgccagaacactattcaaccaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcgtcaagaaacttctacgacagcg
aactgccccggatgtggatacttacaaggagatttcgtattttgttgcagagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggggaaatggcataatcacatgcctatgctggtagagtcagtggcccacaagaagaggaaa
atggctttgtaa
>gnl|bcl2dbcds|A0A2I3HNF3_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2A1 (length=528 residues).
atgacagactgcgaatttggatatatttacaggctagctcaggactatctgcagtacgtcctacagataccacagcctgg
atcaggtccaagcaaaacgtccagagtgctacaaaacgttgcgttctcagtccaaaaagaagtggaaaagaatctgaagc
cgtgcttggacaatgttaatgttgtgtccatagacactgccagaacactattcaaccaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcgtcaagaaacttctacgacagcg
aactgccccggatgtggatacttacaaggagatttcgtattttgttgcagagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctctctttcctgaagcaatactgttga
>gnl|bcl2dbcds|G1R3W6_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L10 (length=696 residues).
atggttgaccagttgcgggagcgcaccgagcggctgctggccgactacctggggtgctgcgcccgggaacccggcacccc
cgagccgacgccgtccacgcccgaggccgccatgctgcgctccgcggccgccaggttacggcagctccacccgtccttct
tctccgcctacctcggctaccctgggaaccgcgtcgagctggtggtgctgatggcggattccgtgctctccgacagcccc
ggccccacctggggcagagtggtgacgctcgtggccttcgcagggacgctgctggagagagggccgctggtgaccgcccg
gtggaagaagtggggcttccagccgcggctaaaggagcaggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcgcctcgtggggcagcaccgcgcctggctgcaggctcagggcggctgggtgagcacgcggcggacaccg
ggacacggggcgggacgggcagccgggaagcgcccacgaggccggcacggatggcttttgtcacttcttcaggaccccct
ttccgctggctttttggagaaaacagctggtccaggcttttctgtcatgcttgttaacaacagccttcatttatttctgg
acacgattattatgagttttaaaacttttaacccgcttctacctgcacagctgtga
>gnl|bcl2dbcds|G1RER8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L1 (length=651 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggc
>gnl|bcl2dbcds|G1RYB4_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacttggagacgcggc
tggctgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctgtttagaggaag
gcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctacc
gcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|G1RYB4_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacttggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|C3VIT1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Odontesthes bonariensis GN=BCL2L1 (length=708 residues).
atgtctcaaaacagagaactggtggttttctacataaagtataaactctcccagagaaactatcctctcaaccacatagt
gctcaatgagcctccgaacaggactggtgccggggacgggggtctgggcgaggagcagagcacagagacgcacgccaacg
ggacttttaccgggaccagtcccgggaccccgccggtgtcccctctgaggcagcaaccgttgccgtcgacgacgacgacg
acgcgcctggacgcggtgaaagaggccctccgagacacggccaacgagttcgagctgcggtacgcccgcgccttcagcga
cctccacagccagctgcacatcacgccggccacggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacg
gcgtcaactggggtcgcatcgtggggcttttcgctttcggcggggcgctgtgcgtggagtgcgtggagagggagatgagc
cccttggtgggcaggatcgtggagtggatgacggtctacctggacaaccacattcagccctggatccagagccagggagg
atgggaacgcttcgctgagatcttcgggcaggacgcggcggccgaaagcaggaggtctcaggagagcttcaagaagtggc
tgctggtggggatgaccgtggtgaccggggtggtggtgggctcgctgttcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A286MU87_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus mykiss GN=BCL2L1 (length=651 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctatagactgtcccagaggaattattcatgttgtcaatt
ggggctggagggtgcaagtggacggactgacggagatgaggccattgcaaatgggtctgtggggaactaccggaacagca
gaagcaatttggcgaagccctcatctccacaggggggcatggagccagtgaaagcagcactacgggactcagtggatgag
tttgagctacgctacacccgtgccttcagtgacctctcctcccagctccacatcacccctgccacagcctaccacagctt
tgagagtgtgatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggtctgtttgctttcggcggggcct
tgtgtgttgagtgtgttgagaaggatatgagcccgctggtggcgcgcatcgcagattggatgaccacctatctggacaac
catatccagccctggatccagagccaaggcggatgggcagagatctttggcagagatgctgctgcagacgttcgacggtc
tcaggagagcataattaaatggctgctagttggggtgattctgctttcaggagtgctggtcggcactctcatcatgaaga
aacgccagtga
>gnl|bcl2dbcds|I3IZK7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oreochromis niloticus GN=BCL2L1 (length=705 residues).
tacaaaatgtctcaaaacagagaactggtgcttttctacataaggtataaactctcccagagaaactatcctctcaacca
catagtactcaacgagcctttgaacaggactgatgggggggcggcggggttggatgaggaacagcgaatagacacacacg
ccaatgggacttttaatggcacgagtcccgggacccctccggcatccccgcagcggcagcagcagccgccatcaacgacg
gacctcgacgcagtgaaggaggcgctccgggacacggccaatgagttcgagctgcgatacgctcgtgccttcagcgacct
tcacagccagctgcacatcacgccggccacggcctaccaaagctttgagaacgtgatggacgaggtgttccgggacggcg
tcaactggggccgcatcgtagggctttttgcgttcggcggggcactgtgtgttgagtgcgtcgagaaggagatgagcccc
ttggtgggcaggatcgtagagtggatgaccgtctacctagacaaccacattcagccctggatccagagccaaggaggatg
ggagcgcttcgctgaaatcttcgggcaggatgcggcggctgaaagccggaggtctcaggagagtttcaagaagtggctgc
tggtggggatgacggtggtgacgggcgttgtggctggtgctcttatcgcgcaaaaacgcctgtga
>gnl|bcl2dbcds|I3J363_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Oreochromis niloticus GN=BCL2L10 (length=708 residues).
atgtcgagaggcggagtcacacattctctatcagctgaagggaagactcaactgtaccgacgctctccttccgccgtctg
tatgtgcagagagcagtctgatatcgctgggaggaaaatgaaattctgtgggctgtggaaagagaccctgcttttggccg
aggactacctgtccttttgctgcacgagtccacatcaagcccctccacctcccagcgaatcagccgctgccatgaggcgt
ctgggctgggacatcgaaagacagcaccaagctcgcttcgacaacctcgctcagaccttcctggtgcagtgtgggccgga
ccactgcctcagcctcagaaaggtgatgaaggagctggttggagatggacacttgaactgggggagggttgtttctcttt
ttgcctttactggagtgctggccagaaagatcctggagcagaagccggggctggaccctgggcaacagcaggaactggga
caggagcccatgagctgcagaaggctggcagagaccatagctgattacctgggagaagagaagaaagactggctgttgga
taatgatggatgggaaggcttctgtaagttctcccgcagtgccagagaagtgagccaggactcatccatgaagaaagcgc
tgtttgctgccgccggtgtcggccttgctgggcttaccttcctcttggtcaaaggcttcagattttga
>gnl|bcl2dbcds|I3JHR5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oreochromis niloticus GN=MCL-1 (length=837 residues).
atgaccaactttttgatgtcgaaaaggaaccagtgtaccttcatagactatcttcttcctcaaaatggagtcctggaggg
accaatgcactatggatcggggaaatcctctccgcagaatgccacaggctcctctaaagactctagcaacgggattgtgt
ctaatggtacccccaaacggccgaacaacctcggggtaacctcaacaaacgggtatacaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtatcatttggacggtgaatccgacgaggagctggagagagaaacgaa
actccttattcacagttttttgggtgattttactggactttctcagcctcaacgaaaggaaaccaaagcactaaaaacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaactgtcattggatgaa
agacacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttgcagaccacacgaccaactggggtcgtattgt
cagctttgtggccttcggagcagtggtgtctcagcacctgaaggaaaagggcagagacaactgcgtggcgctagtgagcc
aagaggtttctgcatacctgctgtctgaacagcgagactggattgtcaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtccacggtcaggaacacactcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcaggttctgggatgcattattgtga
>gnl|bcl2dbcds|I3KXG5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oreochromis niloticus GN=MCL-1 (length=507 residues).
ctggagagagaaactaaactcattattcacagttttttgggagactttactggactttctcagcctcaacgaaaggaaac
caaagcactaaaaatgatgaaaagagttgttgcggacgtattagaaaagcacagatatgcttacaacggaatgattaata
aattgtcattggatgaaagagaagaagatatgtcatttgtagcgaagagcctctttggagaccacacgaccaactggggt
cgtattgtcagctttgtggccttcggggcagtggtgtctcagcacctgaaggaaaagggcagggacaactgcgtggtgct
agtgagtcaagagatttctgcatacttgctgtctgaacagcgagactggattatcaaaaacaatgcatgggatggctttg
tggcgttcgttcgagtagcagaccctgagtcgatagtcaggaacacactcatggcctttgctggatttgcttgtattggg
gcaacactggcactgttgatcaggtga
>gnl|bcl2dbcds|F6S8G3_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Ornithorhynchus anatinus GN=BCL2A1 (length=528 residues).
atggacgacggtgtattctggtccgtccgagccctggctctggactatctggatgacgtcctccagacgccgcgacttgg
gacggtcccaagcagaacttctcgggcgctgcaaaacgtcatgttctcggtccagggggacgtggagaaggctctgaagc
cgtgcttcgacagtctcgacgttggctcggtaggggcagccagaagaatcttcggccaaattgtggaaaaggagttcgag
gacggcatcgtcaactgggggcggattgtgacgatatttgtcttggggggcattctcaccaagaagctccaaaggagcgg
agtcccgctgacgagagagactcgggaggagatttcttgtttcatcgcggagttcaccacccaccacgccggagagtgga
taaggcagaacggaggctgggaaaatggatttttaaataagtttgaacaaaagaccgtctggtcggtgttagcggatatt
tcgatgaagatcttgggcgtactctcccacctgaagcaattttactga
>gnl|bcl2dbcds|F7G6M3_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Ornithorhynchus anatinus GN=BCL2L2 (length=735 residues).
atgccaagtgcccggaattctcccctcccccgccagtcggccgcccctcagccctgctgtcttgccccctgcccctccag
gccccccggcagccctcctgacgcccctccacggcctccccctccccgctgtcctgcagccccccggatggcgaccccgg
ccccggcctcggtctcagacacccgggccctggtggcggactttgtgggctacaagctgcggcagaagggcttcgcctgc
ggggccgggcccggggagggccccccggcccagcccctgcaccgggccatgcgggccgccggggacgagttcgagtcacg
cttccggcgggccttctcggacttggcgtcccagctgcacgtgacgcccggctcggcccagcagcgcttcacccaggtgt
cggacgagctcttccagggggggcccaactggggccggctggtggccttcttcgtgttcggggccgcgctctgcgccgag
agcgtcaacaaggagatggagcccctggtggggcaggtgcaggactggatggtggcctacctggacacccagctggccga
ctggatccgcagcagcgggggctgggcggagttcacggccctgtacggggacggggccctggaggacgcccggcgcctgc
gggagggcaactgggcctccgtccggaccgtgctgacgggggccgtggcgctgggagccctggtgaccgtcggggccttc
ttcgcgagcaaatga
>gnl|bcl2dbcds|G1T1L8_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BCL2A1 (length=600 residues).
atgttcgcctcccagggcttcggaagcttccagaagaagcagtcaccggctctgctctccgagcagcagaagatgagtga
ctgcgagtttggctatgtgcacacactggctcaggactatctgctgtacatcctgaagacgccacagcctggactgggac
cgagcaaaacgtccagggtgctgcagaacgtcaccttctccatccagcaagaagtggaagaggctctgcaaccgtacctg
cacaatgtgcctgtcgcgtccgtcgagactgccaggacaattttcaaccaagtgatggagaaagagtttgaggatggtgt
gatcaactggggcaggattgtgaccatatttgcattcgaaggggtcctggccaagaagctcctccaggagcaggctgttc
cggatgtggacacgttcaagtccatcccttattttgtggctgagttcataacgaggaggatgggagaatggataaggcaa
aacggaggctgggaaaatggatttgtaaagaagtttgaacataattctggttggaagatttttctggaagttgcaaaaca
gatctgtgtgatactgtcgttgctgaagaagtactgctga
>gnl|bcl2dbcds|G1T264_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BCL2L10 (length=573 residues).
aggccccagcggaggctggccatggcagacgctttggaggagcgcactgcgcgcctgctcaccgactacctggagtgctg
cgcccgcgagcccggcacccctgagccgcagccgtccacgccggaggcggctgtgctgcgctgtgcggccacgcagcttc
agcgggtccactggcccttcttctccgtctaccgcggctaccccggcaaccgcatcgagctggcggcgcgcgtggcggag
gccgtgctctccgacggccacgacctcagctggggccgcgtggtgacgctcgtgaccttcgccgggacgcttctggacag
agggccgccggtgaccacccagcgggtgaggaggaatgaaatcgcccgggactgccagcgcttggtggccttgctgtgcg
ctcgcctcgcagggcagcaccgcgcctggctgcaggctcaaggcggctgggatggcttttgtgtcttctaccggactccc
ttaccgctgaccttctggagaagactgctggtccgcacttttctgtcctgctttgtagctacagccttactcttcgcctg
gacgcgcgtgtat
>gnl|bcl2dbcds|G1T2Q0_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryctolagus cuniculus GN=MCL-1 (length=1050 residues).
atgtttagcctgagaagaaacgcggtaatcggactcaacctctacttgggggggcccgggttgggagccggtggcggcgg
cgtcgcccctccggcagagcggcttttggctgcggagaaggaggccgcggcccggctagaggtagggggaggggaggccg
gcgcggtgattggcggaagcccgggcgctagccccccggccgcgctggcgccggacgcccggagggtcgcgcggccggcg
cccattggcgccgagctccccgacgtcagcgcgacccccgcgaggctgctgtacttggcgcccacccgccgcgcgtcgcc
gctcgaggagatggaagccccggctgcggacgccatcatgtcgcccgaagaggagctggacggctacgagccggagcccc
ttgcgaagcggccggccgtcctgcccctgctggacttggtgggggaggccagtaaggtccctagcacggacgggtcgctg
ccctcgacgccgccgcccgcagaggaggaggaggacgagttgtaccggcagtcgctggagattatcgcccggtaccttcg
ggagcaggcgaccggcgccaaggacgcgaagccgatgggccgggccggcagcgcgagccggaaggcgctcgagaccctgc
ggcgggtcggggacggtgtgcagcgcaaccacgagacggccttccaaggaatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgatggcgtaacaaactggggcaggattgtgactct
gatttctttcggtgcctttgtggccaaacacttgaagagcataaaccaagaaagctgcatagaacctttagcggaaagta
tcacagatgttctcgtcaggacgaaacgggactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaagcggcatcagaaatgtgctgctggcttttgcgggtgttgccggagtaggagcggggctggctta
tctgataaga
>gnl|bcl2dbcds|G1T2Q0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryctolagus cuniculus GN=MCL-1 (length=999 residues).
atgtttagcctgagaagaaacgcggtaatcggactcaacctctacttgggggggcccgggttgggagccggtggcggcgg
cgtcgcccctccggcagagcggcttttggctgcggagaaggaggccgcggcccggctagaggtagggggaggggaggccg
gcgcggtgattggcggaagcccgggcgctattggcgccgagctccccgacgtcagcgcgacccccgcgaggctgctgtac
ttggcgcccacccgccgcgcgtcgccgctcgaggagatggaagccccggctgcggacgccatcatgtcgcccgaagagga
gctggacggctacgagccggagccccttgcgaagcggccggccgtcctgcccctgctggacttggtgggggaggccagta
aggtccctagcacggacgggtcgctgccctcgacgccgccgcccgcagaggaggaggaggacgagttgtaccggcagtcg
ctggagattatcgcccggtaccttcgggagcaggcgaccggcgccaaggacgcgaagccgatgggccgggccggcagcgc
gagccggaaggcgctcgagaccctgcggcgggtcggggacggtgtgcagcgcaaccacgagacggccttccaaggaatgc
ttcggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgatggcgta
acaaactggggcaggattgtgactctgatttctttcggtgcctttgtggccaaacacttgaagagcataaaccaagaaag
ctgcatagaacctttagcggaaagtatcacagatgttctcgtcaggacgaaacgggactggctagtcaaacaaagaggct
gggatgggtttgtggagttcttccatgtagaggacctagaaagcggcatcagaaatgtgctgctggcttttgcgggtgtt
gccggagtaggagcggggctggcttatctgataagatag
>gnl|bcl2dbcds|G1TV33_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BCL2L2 (length=651 residues).
ctgagcctctgtctacatattcccgatattcatgccggtctttcatccttgcctcttacagccgcccggatggcgacccc
agcctcagccccagacacacgggctctggtggccgactttgtaggctacaagctgaggcagaagggttatgtctgtgggg
ctggccctggagagggcccggcagctaacccgctgcaccaagccatgcgggcagccggagatgagttcgagacccgcttc
cggcaaaacttctccgacctggccgctcagttgcatgtgaccccaggctcagcacagcagagcttcacccaggtctgcga
tgaacttttccaaaggggtcccaactggggccgcgtggtggccttctttgcctttggggccgcactgtgtgctgagagcg
tcaacaaggagatggagcccctggtgggacaagtgcaggagtggatggtgacctacctggagacgcagctggccggctgg
atccacagcaccgggggctgggcggagttcacagctctgtacggggatcgggccctggaggaggcgcggcgtctgcggga
ggggacctgggcgtcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtaggggccttttttg
ctagcaaatga
>gnl|bcl2dbcds|G1TW27_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BCL-2 (length=681 residues).
atggcgcacgccgggcgaacagggtacgacaaccgggagatcgtgatgaagtacatccactataagctgtcccagagggg
ctacgagtgggacgctggggacgcgggcgccgcctccgcgccgggcgtcttctcctcccagcccgcgcccgctgcgcccc
gggacccggccgccaggacctcgccgccgccgccgccggccgccgcggggcccgcgctcagcccggtgccacctgtggtc
cacctgaccctccgccaggcgggcgacgacttctcccggcgctaccgccgcgacttcgcggagatgtccagccagctgca
cctgacgccctttcacgcgagggggcgctttgccacggtggtggaggagctcttcagggatggggtgaactgggggagga
ttgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggacaacatc
gccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggataatggaggctgggatgccttcgtgga
actgtacggccccagcgtgcggcctctgtcagacttctcctgggtgtctctgaagactttgttcagcctggccctgatag
gagcttgcatcaccctcggtgcctacctgggccacaagtga
>gnl|bcl2dbcds|Q9MYW4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcgcagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccggaagggactggaccagagatggagacccccagtgccatcaatggca
acccagcctggcacccggcggacagccccgcggtgaacggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatgacagcagtgaagcaggctctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagcga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaagtagtgaacgaactcttccgggatg
gggtgaactggggccgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtggacaaggagatggag
gtattggtgagtcggatcgcggcgtggatggccacttacctgaatgaccacctggagccctggatccaggagaacggcgg
ctgggacacgtttgtggaactctacggcaacaacgcagcagccgagagccgcaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgaccgtggctggcgtggttctgctgggctccctcttcagccggaaatga
>gnl|bcl2dbcds|H2MBQ3_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L10 (length=642 residues).
agagtgataaggttctctttacgccgtctcagtgcgcagttgcttgatatcgctgggaggaaaatgtcttgtgggctgag
gaaagagaccctagctgtggccctggattacctgtccctgagctgcaggagcccactccaggcccccccacctcccagcg
agtcagctgctgccatgaggcgcctggcccaggacatggaggcgcagtaccagccccgcttctccaccttagcacagaac
ttcaggaagcacagcgggccggacctgtgctccagcctcaggaaggtgatggaggagctggtgggagatgaacgcttgaa
ctgggggagggtcgtttccctttttgcattcgtgggagtgctggcgaggcagctgagggagcaaacagacatgaacccgg
ggctggaccccgggcgggaagtggcgcccgggcctgtgagctgccaggcgctggcagaaactgtagctgatttcctggga
ggagacaagaaagaatggatgctagaaaatgatggatgggaaggcttctgtaagttctccagaacagccagagaggtgag
tcaggactcgtccatgaagactgcgctcttcgcggcggccagcgtgggcctggctggactcaccttcctcctggtgcgct
ag
>gnl|bcl2dbcds|H2MFY6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L1 (length=666 residues).
caagctcacacaatgtcccactgtaacagagagctggtccggttctatttagcctataagatgtcatgcagggactatcc
tgtgtccctgctgaagcccacagacgatgggggagaaactgaagaggaccactccgatgcccggaatcgcaggctggtca
gcagtgaggacggccggctgaggaggtcctgtccctgttgtgctagcatggacgccatcaaatcaactctcaaagattcg
gccgatgagtttgaacgtcgtttccatcaaggttttagtgatctctccgtgcagcttcatatcactccagacacggccta
ccaaaacttcaaaagggtgttggatgagctgttcaaggatgggatcaactgggggcgcgttgtgggtttgtttgtctttg
gtggtgcgctgtgtgtcgagtgtgtcgagaggaatatgggtgagctggtctcccgcattgctgaatggatgacccagtac
ctggatgagcaaataagtccatggatccacagtcatggaggatgggattgctttgcacggctgtatggccagaacggcgc
tgcagaagcgaggagatttcaagagacgctgaagaagtggatgctggtcacagtggcccttttaactggactgctgctgg
gtgtgctcatcaccaagaaacggtga
>gnl|bcl2dbcds|H2MLZ3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryzias latipes GN=MCL-1 (length=807 residues).
atgtttcctttgcaaaaacagatggttaacagctacatcacgtctaactgtggatttacgggacacatcctcggcagcag
agcgggagagatgtccgcgcgcgtgcctctgccgtccacattagcctctcacgtggcaaaccccgacccgtccgatcagc
tcaaaagaccgcaggacctcgagtattccgcgaggaggtttcacgacgtcgacgacgatggctctctccccaacaccccg
gagttggagtgcgaggccagcgtttccggcgacaactcgggaatcgacgctttaaacgaggacaccacggaattcctcac
caatttctttaggaactttgttggaatttctcagtatcggcaccgggataataaatacatgtcgaccgcgaaaagagtgg
tgaacgacgtgttagagaaacacaagattacttacaacggtatgatcgtcagactgtcgttggacgaccagggggatgat
atgtcatttgtcagcagcgtagcgaagagcctttttgcggatgggaccaccaactggggccgcatcgtcagcctgctggc
cttcggggcggcggtgtgtcagtccttgaaggaaaagggcagaggtcactgcgtggacctggtcagtcaggagatctgca
cgtacctgctgagtgagcagcggaactggctggtcaacaacaactcctgggatggtttcgtagagttctttcgcgtttca
gacccagaaacgacagtcaggaacactttggtggccttccttggaattgctggcgttggggctttactggcccagcttag
taggtga
>gnl|bcl2dbcds|C1BLI0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Osmerus mordax GN=BCL2L1 (length=669 residues).
atgtcttacagtaaccgtgagctggtggtgttcttcataagctataaactttcacagaggaattatcctatttctcagtt
gggactggaagatgccagtgaacggactaatgttgacaagaccaatgtctccccagttaatggatctgttgaaaatgacc
gaaattgcataggcagtctggggatatcttcatctccacaggggggtatagaggcggttaaagcagctcttagagactct
gcagatgagtttgaattgcgttacaccagagccttcaatgatccctcttctcaactgcatatcacccctgctacagcata
ccatagctttgaaagtgtaatgaacgaggtgttcagggacggcgtcaactggggacgtgtagtaggcctgtttgcttttg
gtggtgctctttgtgctgagtgtgtcgagaaggatatgagtcacctggtagcgcgtattgcagattggatgaccacctac
ctggacaaccacatccagccatggatacagagacagggtggatgggaccgatttgctgacattttcggcagggatgctgc
tgctgaggttcgacgttcccaggagaacctaagaagatggctgctagtaggggcgatactgcttgcaggagtgttggtcg
gctctctcattgcaaagaaacatcattga
>gnl|bcl2dbcds|H0WKI0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Otolemur garnettii GN=BCL-2 (length=717 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgctggagacgtgggcgttgcaccccccggggccgccactgcgccgggcgtcttctcctcccagcccg
ggcgcacccctactcccgctgcgccccgggacccggccgccaggacctcgcccccggccgcccccgccgccgccgccgcc
gcggagcctctgctcagcccggtgccacctgtggtccacctgaccctccgccaggcgggcgatgacttctctcgccgcta
ccgccgcgacttcgccgagatgtccagccagttgcacctgacgcccttcaccgcgagaggacgctttgccacggtggtgg
aggagctcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggagagc
gtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctg
gatccaggataacggaggctgggacgcctttgtggaattgtatggccccagcatgcggcctctgtttgacttctcctggc
tgtctctgaagaccctgctcagcctggccctggtgggagcttgcatcaccctgggtgcctacctgggccacaagtga
>gnl|bcl2dbcds|H0WZ06_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Otolemur garnettii GN=BCL2L10 (length=576 residues).
atggcagacccgttgagggagcgcaccgagcggctgctgactgactacctggagtactgcgcgcgggatccgactgcccc
ggagccgacgccgtcctcgcccgaggccgccttgctgcgctccgtgaccgcctatatacagcagcgccactggtcctttt
tctccgcctacataggctaccccgggaatcgcgttcaggtggtggaacggatggtgaaggctatgctctcagacaaccag
agactcaactggggccgagtggtgacgctcgtgaccttcgcagggacgcttctacagaggcctccagtagaagccaggcg
ggagaagcaggacaagtcgcaactgaaggagggagaagacgaagtcgccagggattgccagcgcctagtggccctactga
gctctcggctggtggggcagcaccgcgtttggctggaggctcaaggcggctgggatggcttttgtcagttcttcaggaca
cccttaccgctagctttttggagaagattgctgttcgaagttttactgttgtgctttttagcaacggtcttcatctattt
ctggacacgacttact
>gnl|bcl2dbcds|H0WZ23_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Otolemur garnettii GN=BCL2A1 (length=522 residues).
atgactgactgtgagtttggatacattcacaggctggctcaggactatctgcagtatgtcctgcaaatacagcaatgtgg
atcaggtccaagcaaaacgtccagagtgctgcaaaatgttgcattttcagtccaagaagaggttgaaaagagtctgaaac
catgcttagacaattttaatgttgtatccatagatactgccagaacaatattcaatcaagtgatggaaaaggaatttgaa
gatggcatcattaactggggcaggattgtgacaatatttgcctttggaggtattctcctcaagaaacttctccaacagcg
aattgccctggatgtggatacttataaggagatttcttattttgttgctgagttcataatgaattacacaggagaatgga
taaggcaaaatggaggctgggaacatggctttgtaaagaagtttgaacctaactctggctactctggctggctgactttt
ctggaagttacaagaaagatctgtgaaatgctgcctctcctg
>gnl|bcl2dbcds|H0X6V2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Otolemur garnettii GN=BCL2L1 (length=699 residues).
atgtctcagagcaaccgggagctggtggttgactttatctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagaacaggactgaggccccagaagggaatgaatcagagctggagacccccagtgccattaatggca
acccatcctggcacctggctgacagccccacggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcactgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatctcagctgcacatcaccccagggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgaattgtggcctttttctccttcggcggggctctgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacttgaatgaccacctagagccttggatccaggagaacggcgg
ctggtggaggtgtcaggcctttccagagcttctctctcccaaatcaaattccatttatttcaaagtttgcatgtgtggca
atttttgctctttggctgcagctgggagatgcttgactataggagttatgggttattct
>gnl|bcl2dbcds|H0XFB7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Otolemur garnettii GN=MCL-1 (length=1053 residues).
atgtttggcctcaagagaaacgcagtgatcggactcaacctctactgtgggggcgccgggctgggggctggcagcggcgg
cgccacacccccgggagggcggcttttggctgcggagaaggaggccgcggcccggcgagaggcagggggaggggaagccg
gcgaggtgattggcggaagccccggcgcgagttccccggcctccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggtgccgaagtccccgacgtcaccgcgacccccacgaggctgctgttcttcgcgcccaccctccgtgcggcgcc
gcgggaggagatggaagcccctgccgccgacgccatcatgtcgccggaagatgagctggacgggtacgagccggagcctt
tggggaagcggccggcggtcctgcctttgctggagttggtcggggaggccagtaacggccccagcactgatgggtcactt
ccttcgacaccgcccccagcagaggaggaggaggatgagttataccggcagtcgctggagatcatctctcggtaccttcg
ggagcaggcgaccggtgccaaggacgcgaaaccaatgggcagggcaggagccgccagcaggaaggcgctggagaccttgc
gccgcgttggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggcgtaacaaactggggcaggattgtgactct
aatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttcttgtaaggacaaaacgggactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcgggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|H0XHA5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Otolemur garnettii GN=MCL-1 (length=582 residues).
ctaccagaccagatggaagcccaagttgccgatgccgtcaagtcgcccgaaggtgaggtggcctcgtgcgagccggagcc
tctcaagaagcaaccggagggcctgcctttgctggagtttgttggtgaggccggtaacggccccagcactgacacacttc
cttccacacctcccccagcagaggaggaggatgagttatactggcagtcgatggagatcatctctcggtacctatgggag
caggaaactggagaggatatcaactctttgtctcgagtgatggcccatgttttcagttacggcgtaacaaattggggcag
gattatgaccctaatttttggtggctttgtggccaagcacctgaagaccataaaccaagaaggctacatcaaaccgctag
aagaaaatatcgcagatgtccttgtgaggacaaaaccggactggctagtcaaacaacgaggctgggatggctttgtggag
ttcttctacctggaagacctggaaagcagcgtcagaaacgtgctgctggctttcgcaggtgttgctggagtaggagctgg
cttgacctatctaataagatag
>gnl|bcl2dbcds|H0XR82_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Otolemur garnettii GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctggtggcagactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggcccaggggagggcccagcaactgacccgttgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgtaccttctctgatctggcagctcagctacatgtgaccccaggctcagcccagcaacgcttcacc
caggtctctgatgaacttttccaagggggccccaactggggccgccttgtggccttcttcgtctttggggccgcactgtg
tgctgagagtgtcaacaaggagatggagccactggtgggacaagtgcaggagtggatggtagcctacctggagacacggc
tggctgactggatccatagcagtggtggctgggcggagttcacagctctatacggggacggggccctggaggaggctcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacaggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|Q9MZS7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ovis aries GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggacagaatcagatatggaaacccccagtgccatcaatggca
acccatcttggcacctggcggatagccctgcggtgaatggagccaccggccacagcagaagcttggatgcccgggaagtg
atccccatggcagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacgtcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggctacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacgtttgtggaactctacgggaacaacgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|W5PSA5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ovis aries GN=BCL2L1 (length=699 residues).
atgtctcagagcaaccgggaactagtggttgactttctctcttacaagttttttcagaaaggatacagctggagtcagtt
tagtgacatggaagagaacagaactgagaccctagaagggacagaatcagatatggaaacccccagtgccatcagtggca
acccatcctggcacctggcagatagccctgtggtgaatggagccactggtcacagcagaagcttggacaccgggaaaatg
atccccatggcagtggtgaagcaagccctgagggaggcaagcaatgagtgtgaattgaggtaccaacagacattcagcga
cctgacgtcccagctccacatcaccccagggaaagcatatcagagctttgaacaggtaataaatgaactcttccaggatg
gggtgaactggggtcgcaatgtggcctttttctccttcggtggggcactatgcatgaaaagcatagtcaaggagatgcag
gtattggtaagtcaggtcacgacttggatggccacttacctaaatgaccacctagagccttggatccaggagaatggcga
ctgggacatttttgtggaactctacgaaaacaatacagcaaccgagagccaaaagggccaagagcacctcaaccgctggt
ccctgacggacatgactgtggccggtatggctctgctgggcttgctcttcaactgtaag
>gnl|bcl2dbcds|W5Q0N6_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Ovis aries GN=BCL2A1 (length=528 residues).
atgactgacactgagtttgactacgttcacaagctggctgaggactatctgaaatatgtgttgcagatacagcaacctgg
atccaagccaagcaaaacatccagggtgttacaagacgtggcttcctctgtccaggacgaagtggaaaggactctgaagc
agtgcttggataagtttgatgtggtgtctgtagacactgccagaacaatattcaaccaagtgatggaaaaggaatttgaa
gatggcattgttaactggggcaggattgtaaccatattcgcctttgaaggtattcttaccaagaaacttctgagcaagcg
tattgcctcagacatggacatgtgcaaggacatttcttatttcgtggcggagttcatcaccaaaaacacaggagagtgga
taaggcaaaacggaggctgggaaaatggttttgtaaagaagtttgaaaccaaatctggctggctgacttttctggaagtt
acaggaaagatctgtgaaacattatgtcgtctgaagcaatactattga
>gnl|bcl2dbcds|W5QDH5_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Ovis aries GN=BCL2L2 (length=669 residues).
atgggctggccaaacctgaaatacctccttctgggcctctcaccatatattcatgccagtcttttatgtttgactccaac
agccgcccggatggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtgggctataagctgaggc
agaaggggtatgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctgga
gatgagtttgagacccgcttccggcgcaccttctccgatttggcagctcagctgcatgtgaccccgggttcggcccagca
gcgcttcacccaggtctctgatgaactcttccaagggggccccaactggggtcgccttgtggccttctttgtctttggag
ccgcattgtgtgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctg
gagacgcggctggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctgga
ggaggcgcggcgtctgcgggaggggaactgggcttcagtgaggacagtgctgacgggggccgtggcactttcgctagctg
agggctctggccgcttttttgcagaaagt
>gnl|bcl2dbcds|W5QDH5_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Ovis aries GN=BCL2L2 (length=1092 residues).
atgggctggccaaacctgaaatacctccttctgggcctctcaccatatattcatgccagtcttttatgtttgactccaac
agccgcccggatggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtgggctataagctgaggc
agaaggggtatgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctgga
gatgagtttgagacccgcttccggcgcaccttctccgatttggcagctcagctgcatgtgaccccgggttcggcccagca
gcgcttcacccaggtctctgatgaactcttccaagggggccccaactggggtcgccttgtggccttctttgtctttggag
ccgcattgtgtgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctg
gagacgcggctggctgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagttagggagatgga
ggaagaagctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccgggcaatgctg
gcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgca
acagcagaagagctagaagcacacttccatggctgtggttcagtcaaccgcgttactatactctgtgacaaatttagtgg
ccatcccaaagggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgaatccttat
ttagaggaagacagatcaaggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggtttcccacga
gcccgataccgtgcccgaaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
tcgcgtctacaggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|W5QI41_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ovis aries GN=MCL-1 (length=807 residues).
gggagccggaaaccccgccctgccccaggccccgcccctgccttgaccccgccggttaggtgccgtgcgcaaccgccgga
agctttcgctgccttccccatttacgggatgcagataaagaggcagcagcagtggttcaagatgtttggcttcaagaggc
gccctgccgtccggcctttacctttgatggtcggagaagccagtaacaacagtccaggctcggacggctcgctgccctcg
acgccgcccccatcagaggaggaggaggacgagttatatcggcagtccctggagattatctctcagtacctcctggagca
agcaaccggcaccaaggacgcgaagcccctgggcgggtctggggccaccagccggaaggcgttggagaccctgcgcagag
tcggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaacgaagacgat
gtcaagtctttgtctcgagtgatggttcatgttttcagtgacggagtaacaaactggggcaggattgtgactcttatttc
ttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccactagcagaaagcatcacag
atgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtggagttcttccgtgtagag
gacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggcatatctaat
aagatag
>gnl|bcl2dbcds|W5QIG4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Ovis aries GN=BCL2L10 (length=582 residues).
ggtcggccccccggtagaggcggagccatggtggacccgtttagggagcgcacggcccggctgctgatggactggctgga
gttctgcgcccgggagcccggcactccagctcctgcgccgtccacgcccgaggctgctgtgctgcgccacgtggccgccc
gtgtcctggaagcaaatcgaaacgtcttgcccctataccgccgctaccgcaggcaccgcgtcgagctggtggccaggatg
gcgcagaggctgctcgacgaagaccctggccccagctggggccgcgtggcctcactcgtgaccttcgcggggtctctgct
ggagaggcagccgcagacgacccgacggcagaagagagacgacggcagcgttagcagggactgtcggctcctcgtggccc
ttctctgcgctcagttctgcgaaaggcaccgcgcctggctgatggcgaacggcggctgggatggattttgtctctccttc
agccactcattgcaaccatcttgggaaagacagctggtctggtttttcctctcatactggacagcaataatcataatcta
cttctggataaaattatcgtga
>gnl|bcl2dbcds|A0A2R8ZJX9_BCL2A1-03 BCL2-related protein A1 gene OS=[Eukaryota] Pan paniscus GN=BCL2A1 (length=591 residues).
atgacagactgtgaatttggatatatttacaggctggctcaggactatctgcagtacgtcctacagataccacaacctgg
atcaggtccaagccaaacgtccagagtgctacaaaatgttgcattctcagtccaaaaagaagtggaaaagaatctgaagt
catgcttggacaatgttaatgttgtgtctgtagacactgccagaacactattcaaccaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
gattgccccggatgtggatacttataaggagatttcatattttgttgcggagttcataatgaataacacaggagaatgga
taagacaaaacggaggctgggaaaatggctttgtaaagaagtttgaacataaatctggctggatgacttttctagaagtt
acaggaaagatctcaatactgttgaccagaaaggacactccatattgtgaaaccggcctaatttttctgactgttatgga
aacgattgccaacacatacttctacttttaa
>gnl|bcl2dbcds|A0A2R8ZJX9_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Pan paniscus GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatatttacaggctggctcaggactatctgcagtacgtcctacagataccacaacctgg
atcaggtccaagccaaacgtccagagtgctacaaaatgttgcattctcagtccaaaaagaagtggaaaagaatctgaagt
catgcttggacaatgttaatgttgtgtctgtagacactgccagaacactattcaaccaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
gattgccccggatgtggatacttataaggagatttcatattttgttgcggagttcataatgaataacacaggagaatgga
taagacaaaacggaggctgggaaaatggctttgtaaagaagtttgaacataaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctatctctcctgaagcaatactgttga
>gnl|bcl2dbcds|A0A2R8ZJX9_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Pan paniscus GN=BCL2A1 (length=492 residues).
atgacagactgtgaatttggatatatttacaggctggctcaggactatctgcagtacgtcctacagataccacaacctgg
atcaggtccaagccaaacgtccagagtgctacaaaatgttgcattctcagtccaaaaagaagtggaaaagaatctgaagt
catgcttggacaatgttaatgttgtgtctgtagacactgccagaacactattcaaccaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
gattgccccggatgtggatacttataaggagatttcatattttgttgcggagttcataatgaataacacaggagaatgga
taagacaaaacggaggctgggggaaatggcacaatcacacgcctatgctggtagagtcagtggcccacaagaagaggaaa
atggctttgtaa
>gnl|bcl2dbcds|A0A2R9A7B2_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Pan paniscus GN=BCL2L2 (length=507 residues).
atggaggaagaagctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccaccaccaggcaa
tgctggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatg
gtgcaacagcagaagagctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaattt
agtggccatcccaaagggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtc
cctatttagaggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttc
cacgagcccgctaccgcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccc
cggggtcgcgtctacaggtcaggatag
>gnl|bcl2dbcds|A0A2R9A7B2_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Pan paniscus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A2R9A7B2_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Pan paniscus GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcagccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccaccaccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
gggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
gcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctacc
gcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A2R9APW6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Pan paniscus GN=BCL-2 (length=582 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccattataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgcccctcagcccggtgccacctgtggtccacctgaccctccgccagg
ccggcgacgacttctcccgccgctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcg
cggggacgctttgccacggtggtggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagtt
cggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagt
acctgaaccggcacctgcacacctggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatg
cggcctctgtttgatttctcctggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctggg
tgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A2R9BCD9_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Pan paniscus GN=BCL2L10 (length=615 residues).
atggttgaccagtggcgtgagcgcactaccatggccgacccgctgcgggagcgcaccgagcggttgctggccgactacct
ggggtactgcgcccgggaacccggcacccccgagccgacgccgtccacgcccgaggccgccgtgctgcgctccgcggccg
ccaggttacggcagatccaccggtccttcttctccgcctacctcggctaccccgggaaccgcttcgagctggtggcgctg
atggcggattccgtgctctccgacagccccggccccacctggggcagagtggtgacgctcgtgaccttcgcagggacgct
gctggagagagggccgctggtgaccacccggtggaagaagtggggcttccagccgcggctaaaggagcaggagggcgacg
tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcgtggggcagcaccgcgcctggctgcaggctcag
ggcggctgggatggcttttgtcacttcttcaggaccccctttccgctggctttttggagaaaacagctggtccaggcttt
tctgtcatgcttgttaacaacagccttcatttatctctggacacgattattatga
>gnl|bcl2dbcds|A0A2R9BYH6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pan paniscus GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2R9BYH6_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pan paniscus GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggcgctggagaccttacgacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2R9BYH6_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pan paniscus GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2I3T6T8_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Pan troglodytes GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatatttacaggctggctcaggactatctgcagtacgtcctacagataccacaacctgg
atcaggtccaagcaaaacgtccagagtgctacaaaatgttgcattctcagtccaaaaagaagtggaaaagaatctgaagt
catgcttggacaatgttaatgttgtgtctgtagacactgccagaacactattcaaccaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
aattgccccggatgtggatacttataaggagatttcatattttgttgcggagttcataatgaataacacaggagaatgga
taagacaaaacggaggctgggaaaatggctttgtaaagaagtttgaacataaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctatctctcctgaagcaatactgttga
>gnl|bcl2dbcds|A0A2I3T6T8_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Pan troglodytes GN=BCL2A1 (length=492 residues).
atgacagactgtgaatttggatatatttacaggctggctcaggactatctgcagtacgtcctacagataccacaacctgg
atcaggtccaagcaaaacgtccagagtgctacaaaatgttgcattctcagtccaaaaagaagtggaaaagaatctgaagt
catgcttggacaatgttaatgttgtgtctgtagacactgccagaacactattcaaccaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
aattgccccggatgtggatacttataaggagatttcatattttgttgcggagttcataatgaataacacaggagaatgga
taagacaaaacggaggctgggggaaatggcacaatcacacgcctatgctggtagagtcagtggcccacaagaagaggaaa
atggctttgtaa
>gnl|bcl2dbcds|A0A2I3T6T8_BCL2A1-03 BCL2-related protein A1 gene OS=[Eukaryota] Pan troglodytes GN=BCL2A1 (length=591 residues).
atgacagactgtgaatttggatatatttacaggctggctcaggactatctgcagtacgtcctacagataccacaacctgg
atcaggtccaagcaaaacgtccagagtgctacaaaatgttgcattctcagtccaaaaagaagtggaaaagaatctgaagt
catgcttggacaatgttaatgttgtgtctgtagacactgccagaacactattcaaccaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
aattgccccggatgtggatacttataaggagatttcatattttgttgcggagttcataatgaataacacaggagaatgga
taagacaaaacggaggctgggaaaatggctttgtaaagaagtttgaacataaatctggctggatgacttttctagaagtt
acaggaaagatctcaatactgttgaccagaaaggacactccatattgtgaaaccggcctaatttttctgactgttatgga
aacgattgccaacacatacttctacttttaa
>gnl|bcl2dbcds|A0A2I3T6T8_BCL2A1-04 BCL2-related protein A1 gene OS=[Eukaryota] Pan troglodytes GN=BCL2A1 (length=216 residues).
gtggcgcgatcttggctcactgcagcctcgacctccacggctcaagaaaatggctttgtaaagaagtttgaacataaatc
tggctggatgacttttctagaagttacaggaaagatctcaatactgttgaccagaaaggacactccatattgtgaaaccg
gcctaatttttctgactgttatggaaacgattgccaacacatacttctacttttaa
>gnl|bcl2dbcds|G2HFR3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pan troglodytes GN=MCL-1 (length=444 residues).
atggacatttgccggctctcagcagcaatgcgtgaattttacattgtgcatctggatatatacccaccacctgagtgtac
cattcacatgttactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacg
gcgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaa
gaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaag
aggctgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcag
gtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|H2Q805_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Pan troglodytes GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|H2Q805_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Pan troglodytes GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcagccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccaccaccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
gggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
gcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctacc
gcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|H2Q9G4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Pan troglodytes GN=BCL2L10 (length=615 residues).
atggttgaccagtggcgtgagcgcaccaccatggccgacccgctgcgggagcgcaccgagcggttgctggccgactacct
ggggtactgcgcccgggaacccggcacccccgagccgacgccgtccacgcccgaggccgccgtgctgcgctccgcggccg
ccaggttacggcagatccaccggtccttcttctccgcctacctcggctaccccgggaaccgcttcgagctggtggcgctg
atggcggattccgtgctctccgacagccccggccccacctggggcagagtggtgacgctcgtgaccttcgcagggacgct
gctggagagagggccgctggtgaccacccggtggaagaagtggggcttccagccgcggctaaatgagcaggagggcgacg
tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcgtggggcagcaccgcgcctggctgcaggctcag
ggcggctgggatggcttttgtcacttcttcaggaccccctttccgctggctttttggagaaaacagctggtccaggcttt
tctgtcatgcttgttaacaacagccttcatttatctctggacacgattattatga
>gnl|bcl2dbcds|H2QEM8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Pan troglodytes GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccattataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgcccccgggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatccagccgcatcccgggacccggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|K7DE58_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pan troglodytes GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgctggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtccctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|K7DE58_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pan troglodytes GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgctggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtccctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|K7DE58_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pan troglodytes GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggcgctggagaccttacgacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|K7DE58_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pan troglodytes GN=MCL-1 (length=378 residues).
agtgttgaaacgtgcatgcttcggaaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatcca
tgttttcagcgacggcgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttga
agaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactgg
ctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgtgct
gctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A096MPU7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Papio anubis GN=BCL-2 (length=717 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatggcgcggcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccgggc
acacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgccgcc
gcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccgcta
ccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtggtgg
aggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggagagc
gtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctg
gatccaggataacggaggctgggacgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcctggc
tgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A096NM44_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Papio anubis GN=BCL2L10 (length=696 residues).
atggctgacccgttgcgggagcgcaccgagcggctcctggccgactatctggggtgctgcgcccgggaacccggcacccc
tgagccgaggccgtccacgcccgaggccgccgtgctgcgctcagcagccgccaggttacggcagctccaccggtccttct
tctccgcctaccgcggctaccccgggaaccgcgtcgagctggtggcgctgatggcggaggccgtgctctccgacagcccc
ggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgctggtgacagcctg
gtggaagaagcggagcttccagccgcggctgaaggagcaggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcagggcggctgggtgagcacgcggcggacaccg
ggacgcggggcgggacgggcatccgggaagcgcccacgaggccggcacggatggcttttgtcacttcttcaggagcccct
ttccgctggctttttggagaaaactgctgatccaggctttcctggcatgcttgttagcaacagccttcggttatctctgg
acacgattattatgagttttaacatttttaacccacttctacctgcccaactgtga
>gnl|bcl2dbcds|A0A096NMX5_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Papio anubis GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtacgttctgcagataccacaacctgg
attgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcatattttgttgctgagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctatctctcctgaagcaatactgttga
>gnl|bcl2dbcds|A0A096NMX5_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Papio anubis GN=BCL2A1 (length=492 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtacgttctgcagataccacaacctgg
attgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcatattttgttgctgagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggggaaatggcacaatcacatgcctatgctagtagagtcagtggcccacaagaagaagaaa
atggctttgtaa
>gnl|bcl2dbcds|A0A2I3M3D6_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Papio anubis GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttagccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2I3M3D6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Papio anubis GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttagctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaaccgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgacccccgcgaggccgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggctgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctcttggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2I3M3D6_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Papio anubis GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttagctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaaccgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgacccccgcgaggccgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggctgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctcttggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2I3MUE4_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Papio anubis GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A2I3MUE4_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Papio anubis GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agttggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
ggatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
gcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctacc
gcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|K7F5Y4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Pelodiscus sinensis GN=BCL-2 (length=699 residues).
atggctcatcctgggagaagaggctatgataaccgggagatagtgttgaagtacatccattacaaactgtcacagagggg
gtatgattgggctgccaatgaaaacagaggaccagtttcttcaagtctctctcctcctgctgctgggaccccatctgacc
atgctgggctggtgtctttgccgcctgaaccccctggttcggctgctgctagtaatgtgccccttggtgatgggctgcgc
tcagcaccacaggctgttcacttgactctgtgccaagccggagatgaattttcccgccgctatcacagagattttgccca
gatgtctgggcagctgcacttgaccccattcacggccagggggcgctttgtggcggtggtggaggagctattccgagatg
ggattaactggggaaggatcgtggccttctttgaatttggtggcgtgatgtgtgtggagagtgtcaaccgggagatgtcg
cctcttgtggacagtattgctgtgtggatgactgagtacctgaacagacacttgcacaactggatccaggacaatggagg
ttgggatgcctttgtggaattgtatggcagcaacatgaggcctttgtttgatttctcctggatctctttgaagactatcc
tcagtcttgctctggtgggagcttgcatcacccttggagcttatctgggacataagtga
>gnl|bcl2dbcds|K7F5Y4_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Pelodiscus sinensis GN=BCL-2 (length=513 residues).
atggctcatcctgggagaagaggctatgataaccgggagatagtgttgaagtacatccattacaaactgtcacagagggg
gtatgattgggctgccaatgaaaacagaggaccagtttcttcaagtctctctcctcctgctgctggttcggctgctgcta
gtaatgtgccccttggtgatgggctgcgctcagcaccacaggctgttcacttgactctgtgccaagccggagatgaattt
tcccgccgctatcacagagattttgcccagatgtctgggcagctgcacttgaccccattcacggccagggggcgctttgt
ggcggtggtggaggagctattccgagatgggattaactggggaaggatcgtggccttctttgaatttggtggcgtgatgt
gtgtggagagtgtcaaccgggagatgtcgcctcttgtggacagtattgctgtgtggatgactgagtacctgaacagacac
ttgcacaactggatccaggacaatggaggttgg
>gnl|bcl2dbcds|K7F5Y4_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Pelodiscus sinensis GN=BCL-2 (length=585 residues).
atggctcatcctgggagaagaggctatgataaccgggagatagtgttgaagtacatccattacaaactgtcacagagggg
gtatgattgggctgccaatgaaaacagaggaccagtttcttcaagtctctctcctcctgctgctgggaccccatctgacc
atgctgggctggtgtctttgccgcctgaaccccctggttcggctgctgctagtaatgtgccccttggtgatgggctgcgc
tcagcaccacaggctgttcacttgactctgtgccaagccggagatgaattttcccgccgctatcacagagattttgccca
gatgtctgggcagctgcacttgaccccattcacggccagggggcgctttgtggcggtggtggaggagctattccgagatg
ggattaactggggaaggatcgtggccttctttgaatttggtggcgtgatgtgtgtggagagtgtcaaccgggagatgtcg
cctcttgtggacagtattgctgtgtggatgactgagtacctgaacagacacttgcacaactggatccaggacaatggagg
ttgggctggtgcagtgagcgttctc
>gnl|bcl2dbcds|K7F655_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Pelodiscus sinensis GN=BCL2L1 (length=690 residues).
atgtcgaacactaacagggaattagtgattgacttcctctcctacaagctatcgcagaggggacacagctggagctggtt
cgagggggaggatgagatcaggactgaggctgcagaagaggcggagatggcaagcgtccctaatgggagtccatcctggc
atccaggtgccagccacgtagtgaacggggctgccgggcacagtaacagccttgaagcccatgaaagggttccggcagcc
gaagtgaggcaggcgctgagagaggcaggagatgagtttgaattgaggtatcggagggctttcagtgacctcacttccca
gctccacatcaccctgggcacggcttaccagagcttcgagcaggtggtgaatgaactcttccgggacggagtgaactggg
ggcgcattgtggcttttttctcctttggaggagccctgtgcgtggagagtgtggacaaggagatgcaggtgttggtggga
cgcatcgcctcttggatgaccacttacctgactgaccaccttgatccctggatccaagagaatggcggttgggagcgctt
tgtggatctctacgggaacgatgctgctgccaagagcaggaaaggccaggagcagttcaacagggggctgctgacggggg
cgactgtggccggcgtgctcctcctgggctcgctgctgagccgcaagtag
>gnl|bcl2dbcds|K7FPN7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pelodiscus sinensis GN=MCL-1 (length=366 residues).
gggatgcttcggaaactagacatcaagaatgaggaggatctcaagtcagtgtcatcagttgcaacccatgttttcagtga
tggaataacaaactggggtagaattgtaacactcatctcttttggtgcctttgttgcaaaacacctgaagagcataaacc
aggagaattgcatcaacacgctagcagggatcatcacagatgtgcttgtctcagacaaacgagattggctagttaaccaa
agaggctgggagggatttgttgaattcttccgtgtagaggatctagaaggtagcatcaggaatgttctggtggcttttgc
aggctttgctggactgggtgcaagcttggcgtacatgatgcgatga
>gnl|bcl2dbcds|K7G130_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Pelodiscus sinensis GN=BCL2A1 (length=528 residues).
atggaaagttctgagttccgctatgtttactatttagtccaggattatctgaaatacattcttcaggaacctgagcttgg
accagccccaagcagagttgctcatgtcttaagaaattctgcatcttttcttcaaaaagaaaacgaagagatactgaaac
catgtttggacacacttgatattacctctgtagatgctgccagaagaattttcattcaagtcatggataaagaatttgat
gatggaaacactaactgggggcggattttgacaatatttatgtttggaggaattctttctaagaggcttcaagaacacaa
agttcagcttacaggagataataaagagcagatttcttatttcatcacggagtacattataaacaccaaggctgaatgga
tagatgcaaatggaggctgggaaaacggcttcctacctatgtttgaagaaaaacaatcgtggctgtcattattcaacatt
aaagcaaaaatcatggatgctttttccttcttcagtcagtattattga
>gnl|bcl2dbcds|A0A087X830_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Poecilia formosa GN=MCL-1 (length=831 residues).
atgacggctaattcgacaaccgcattaaactatctaattttttctcaaaatggagtcggggatggacaaacacactacga
ccaggggctcgttgtgcctgaagtcgcaatgggagccactgtagattctcttcattcgcctaaggatccctacaagaaac
gcccgacgaatctcgcagtgtccgcatcgaatggatatgttgcaaaaagcctccagaagagcagcgacgacagcgacgaa
ggctctctgccatgcactccagcgcagcaagacagtgaaaccgacgcgtctgctgtacgtgcgagcaaccaagtgctgga
taacgacacaatggagctcattagcagttttctaagaaattttacaggactttcaaagtgtcggtggagtcaaaataaag
ctctatctacgatgaaaagggtggtggaggacgttttgtcgaagcacagatatgcatacaatggtatgctcaacaggctt
gctctggataaccagccggacaatatggggtttgttacggaagtagcagagaatctcttttcagacgggaccaccaactg
gggtcggatcgtcagcctggtggcgttcggggctgcagtgtgtcagcacctgaaggagaggggcagagagcattgcgtgg
agctggtgagcaaggaaatatccacgtatctcctggaaaaccagcgggactggctagcaaaaaacaactcatgggagggc
tttgtggagttctttagagtatcagatcctgagtctacagtgaggaacacgctgatggcgtttgttggggtcgctggtat
tggggcaacattagcctttctcatcaggtga
>gnl|bcl2dbcds|A0A087X9B7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Poecilia formosa GN=BCL2L1 (length=696 residues).
atgtcacgaaacagagaactggtgcttttctacattaagtttaaactgtctcagaggaactatccgatccaacacatatt
gcccaatgagcccccggacagcaccgctgctggggacgcggccggggacgcggggatggacgacgagcagacgttggaga
cgcacgctaatgggacttttaacgggacaagtccaggatccccgaggcggcaacaggcggcgtcggcggcaacgatggac
gcggtgaaagtgaccctgcgagacacggcccgtgagttcgagctgcgctactcccgcgccttcaacgaccttcacagcac
gctgcacatcacaccggccaccgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactggg
gccgcatcgtggggctcttcgcgtttggtggcgcgctctgcgtggaatgcgttgagaaggagatgagccacctggtagcc
aggattgtagagtggatgaccgtctacttggatgagcggattgaaccttgggtggagagccaaggaggatgggaccgttt
cgctgagatcttcgggggcaacgcggcggcagagagcagaagatctcaggagagcttcaaaaactggctgctgctgggga
tgagtgtggtgacggccttcatagccgggtccatcttcgcccagaagcgcctgtga
>gnl|bcl2dbcds|A0A087YBW4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Poecilia formosa GN=BCL2L1 (length=660 residues).
atgtcctacagcaacagagaactggtggagttctacataagctacaaattgtctcagagaaactattcaagctctctgct
gaggtccgaggccgacggggccaggaccaattgggatggggacagccggggccctagcaatggtccgctggtcaacagct
gggccggctccccagggaagtcccgggaccctcccaccggcgtcaaggttgtcaaattggttctgaaggacgcggcagag
gagtttgaacgcctctacacccaaagctttaaacacctttccttgcagctggacatcacccccgacacggcctaccagag
cttcaagaccgtgctggatgagttgttcaagggtgaggtcaactggggtcgggtggtggccatgtttacctttgggggaa
ttctgtgtgtggattgcgttcagaagaatatgagtgagctggtctcccgcattgccgaatggatgaccacttacctggac
gagcagctcaatccctggatccaaagccagggaggatgggaccgcttcgctaacctgtacggccaggatgccgctgcaga
gggccggaggtttcgggagaccttgaacaaatggctgctagtcggtgtggctctgctgaccggagctctgctcgtcatgt
tcgtcgctaagaaacgatga
>gnl|bcl2dbcds|A0A096ME02_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Poecilia formosa GN=BCL2L10 (length=651 residues).
atgcaccgaggttctccttccgccgtctggatgtgcagagagccgtcacatatcgctgggaggaaaatgtcctgtgggct
gtggaaagagaccgtggctgttgcagaggattacatccacctgcgctgctcaagcccacacccagcccctccacctccca
gcgagccggctgccgccatgaggcgcctggcccaggacgtggaggcccagcaccaggctcgctttcactccctggcccag
ggcttcctgaagcactgcgggacagacctctgctccaacctcagaaaggtgatggatgagatggtgggagatggacattt
taactgggggagggtggtgtccctcttcgccttcgctggcgtgctggccagacagctgcgggaacagacgggcaagaacc
cggggccggactccgggaagcagcaggaactgcaacaagagcccgtaagctgccgggcgctggcggagaccattgctgat
tacctggagaagcacaaaaaagactggctgcaggaaaataatggatgggacgggttttgtagctacgcccacaacgccag
agaagtaagtcaggactcctccatgaagacggcgctggttgctgtcgccggagtcggcatcgcagggctcaccttccttc
tggtgcgctag
>gnl|bcl2dbcds|A0A2J8VIH3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Pongo abelii GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagctgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|H2N5Y9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pongo abelii GN=MCL-1 (length=1053 residues).
atgttcggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggtgctggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtctaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgtttttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccattgggcaggtctggggccacctgcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtgaaatcgttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggaggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|H2NN92_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Pongo abelii GN=BCL2L10 (length=615 residues).
atggttgaccagttgcgggagcgcactatcacggccgacctgctgagggagcgcaccgagcggctgctggccgactacct
ggggtgctgcgcccgggaacccggcaccccagagccgacgccgcccacgcccgaggccgccgtgctgcgctccgcggccg
ccaggttacggcagctccaccggtccttcttctccgcctacctcggctaccccgggaaccgcgtcgaactggtggcgctg
atggcggattccgtgctctccgacagccccagccccacctggggcagagtggtgacgctcgtgaccttcgcagggacgct
gctggagagagggccgctggtgaccgcccggtggaagaagtggggcttccagccgcggctaaaggagcaggagggcgacg
tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcgtggggcagcaccgcgcctggctgcaggctcag
ggcggctgggatggcttttgtcacttcttcaggaccccccttccgctggctttttggagaaaacagctggtccaggcttt
tctgtcatgcttgttaacaacagccttcatttatctctggacacgattattatga
>gnl|bcl2dbcds|H2NNZ9_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Pongo abelii GN=BCL2A1 (length=522 residues).
atgacagactgtgaatttgggtatatttacaggctagctcaggactatctgcagtacgtcctacagataccacaacctgg
atcaggtccaagcaaagcgtccagagtactacaaaaggttgcgttctcagtccaaaaagaagtggaaaagaatctgaagc
catgcttggacaacgttaatgttgtgtccgtagacactgccagaacactattcaaccaagtaatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
aattgccccggatgtggatacttacaaggagatttcatattttgttgcggagttcgtcatgaataacacaggaggatgga
taaagcaaaacggaggctgggaaaatggctttgtaaagaagcttgagcctaaatctggctggatgacttttgaagttaca
ggaaagatctgtgaaatgctctctcttctgaagcaatactgt
>gnl|bcl2dbcds|H2NWH5_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Pongo abelii GN=BCL-2 (length=717 residues).
atggcgcacgctgggacaacagggtacgataaccgggagatagtcgatgaaancatccattataagttgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgcccccgggggccgccaccgcacccggcatcttctcctcccagcccg
ggcacacgcctcatccagccgcatcccgggacccggccaggacctcgccgctgccgaccccggctgcccctggcgccgcc
gtggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccgccgcta
ccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtggtgg
aggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagc
gtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctg
gatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcctggc
tgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A2K6EKG1_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Propithecus coquereli GN=BCL2A1 (length=522 residues).
atgactgactgtgagtttggatacacccacaggctggtccaggactacctgcagtacgtcctgcgggttccgcagcccgg
gtccggtccgagcaagacgtccagagtgctgcaaaacattgccttctccgtccaaaacgaagtcgaaaagaatctgaaag
catgcttggacaatgttaatgtggcgtccatagatgccgccagaacgatattcaatcaagtgatggaaaaggaatttgaa
gatggcatcgttaactggggaaggattgtgaccgtgtttgcattcggaggtattctcatcaagaaacttctacgagagca
gattgccctggatgtggatacttacaaggagatttcttattttattgctgagttcataacgaataacgcaggagagtgga
tacggcagaacggaggctgggaacacggcttcgtaaagaagtttgaacctagacctgcctggctgacttttctggaagtt
acggggaagatctgtgacatgctgtccctcctctactcctga
>gnl|bcl2dbcds|A0A2K6F2Q2_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Propithecus coquereli GN=BCL2L10 (length=579 residues).
atgggtgaccggttcagggagcgcaccgagcggctgctggccgactacctggagtactgcacaagggagccgggcgcccc
ggggctgccgccgtcctcgctcgaggccgccgcgatgcgcttcgcagccaccaagatacggcggaagcacgcgtccttct
tctccgcctacgtcggctaccccgggaaccgcgtctacctgctggagcggatggcggaggccgtgctctgcgacagcctc
agctggggccgggtagtgatgctcgtgaccttcgcagggacgcttctagagagagggccgccggtgaccgcctggtggaa
gaagtggggcctccagccgcagccgaaggagggggatcccgaagtcgcccgggaccgccagcgcctggtggccctgctgt
gcgcccggctggcggggcagcaccgcgcctggctgcaggctcaaggcggctgggatggcttttgtgacttattcaggaaa
cccttgccgctagctgtttggaggagactgctggtccaggttcttttgtcatgctttttagcaacgaccgtcatctattt
ctggacacgattattatga
>gnl|bcl2dbcds|A0A2K6F6N9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Propithecus coquereli GN=MCL-1 (length=411 residues).
gatctgtggattaacctggggatcagctgcgggcgggcagatctaggctgggcctggctgggtttgaaggccttccaagg
catgcttcagaaactggacatcaaaaacgaagacgatgtcaaatctttatcacgagtgatggtccatgttttcagtgaca
gcgtaacaaactggggcaggattgtgactttaatttctttttgtgcctttgtgtccaaacacttgaagaccataaaccaa
gagagctgcatcgaaccattagcagaaagtatcacagacattcttgtaaggacgaaacgagactggctattcttccatgt
agaagacctggaaggcagcatcagaaatgtgctgctggcttttgctggtgttgctggagtaggagctggtttgacttatc
taataagatag
>gnl|bcl2dbcds|A0A2K6G3C5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Propithecus coquereli GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tatcgatgcagaagagaacaggactgaggccccagaagcgactgaatcggagatggagacccccagtgccattaatggca
acccatcctggcacctggcggacagccccccagcgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcactgaaggaggcgggcgatgaatttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccctagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgagatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggccctctgcgtcgaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacggaaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K6G3C5_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Propithecus coquereli GN=BCL2L1 (length=438 residues).
atgcagaagagaacaggactgaggccccagaagcgactgaatcggagatggagacccccagtgccattaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgagatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggccctctgcgtcgaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcaact
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
cggaaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgctggttcctgacgggcatgactgtggctg
gcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K6G3I7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Propithecus coquereli GN=BCL-2 (length=705 residues).
atggcgcacgccgggagaacagggtatgataaccgggagatagtgatgaagtacatccattataagctggcgcagagggg
ctacgagtgggatgccggagacgcgggcgctgcgcccccgggggccgcccccacgccgggcatcttctcctcccagcccg
ggcgcaacccccctcccgctgcgcctcgggacccggccgccaggacctcgcccccgcccgccgccgccgcggggcctgcg
cccagcccggtgccacctgtggtccacctgaccctccgccaggcgggcgatgacttctcccgccgctaccgccgcgactt
cgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttca
gggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggag
atgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggataa
cggaggctgggacgcctttgtggaattgtatggtcccagcatgcggcctctgtttgatttctcctggctgtctctgaaga
ctctgctcagcctggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A2K6GI15_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Propithecus coquereli GN=MCL-1 (length=813 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggattgggggccggcagcagcgg
cgccacccccccgggagggcggcttttggctgccgagaaggaggccacggcccggcgagaggtagggggaggggaagacg
gcacggtgattggcggaagccccggcgcaagccccccggcctccctcacgccagaagcccggagggtcgcgcggccggct
cccattggtgccgaagtccccgacgtcaccgcgaccccggagaggctgctgttcttcgcgcccacccgccgcgcattgcc
gtccgaggagatggaagcccctgccgccgacgccatcatgtcgcccgaagatgagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagtaatggctccagcacggacgggtcacta
ccctcgacgccgcccccagcagaggaggaggacgacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcaaccggcgccaaggacgcaaagccaatgggcaggtctggggccgccagcaggaaggcgctagagaccttac
gacgtgtcggggacggtgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttgtaa
>gnl|bcl2dbcds|A0A2K6GI15_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Propithecus coquereli GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggattgggggccggcagcagcgg
cgccacccccccgggagggcggcttttggcaaccggcgccaaggacgcaaagccaatgggcaggtctggggccgccagca
ggaaggcgctagagaccttacgacgtgtcggggacggtgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggcgtaacaaa
ctggggcaggattgtgactctaatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K6GI15_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Propithecus coquereli GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggattgggggccggcagcagcgg
cgccacccccccgggagggcggcttttggctgccgagaaggaggccacggcccggcgagaggtagggggaggggaagacg
gcacggtgattggcggaagccccggcgcaagccccccggcctccctcacgccagaagcccggagggtcgcgcggccggct
cccattggtgccgaagtccccgacgtcaccgcgaccccggagaggctgctgttcttcgcgcccacccgccgcgcattgcc
gtccgaggagatggaagcccctgccgccgacgccatcatgtcgcccgaagatgagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagtaatggctccagcacggacgggtcacta
ccctcgacgccgcccccagcagaggaggaggacgacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcaaccggcgccaaggacgcaaagccaatgggcaggtctggggccgccagcaggaaggcgctagagaccttac
gacgtgtcggggacggtgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggcgtaacaaactggggcaggattgtgactct
aatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2K6GWN0_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Propithecus coquereli GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctggtggcagactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggcccgggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgtaccttctctgatctggcggctcagctgcatgtgacccccggctcagcccagcagcgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtggccttcttcgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggagccactggtgggacaagtgcaggagtggatggtggcctacctggagacacggc
tggccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacaggggccgtggcactgggggccctggtaactgtagg
ggcctttttcgctagcaagtga
>gnl|bcl2dbcds|A0A2K6GWN0_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Propithecus coquereli GN=BCL2L2 (length=1041 residues).
atggcgaccccagcctcagccccagacacacgggctctggtggcagactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggcccgggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgtaccttctctgatctggcggctcagctgcatgtgacccccggctcagcccagcagcgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtggccttcttcgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggagccactggtgggacaagtgcaggagtggatggtggcctacctggagacacggc
tggccgactggatccacagcagtgggggctgggagctggaagccatcaaagctcgggtcagggagatggaggaagaagct
gagaagttaaaagagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggtccagtgat
catgtccattgaagagaaaatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggttgtggttcagtcaaccgtgttaccatactgtgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgagtccctgtttagaggaag
acaaatcaaggtaagcctgtgctttccattgtacatcctttactctcaggtgatcccaaaacgaaccaacagaccaggca
tcagcacaacagaccggggtttcccacgagcccgctaccgtgcccggactaccaactacaacagttcccgctctcgattc
tacagtggttttaacagcaggccccggggtcgcgtctacaggggccgggctagagcgacatcatggtattccccttacta
a
>gnl|bcl2dbcds|F1LNV0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Rattus norvegicus GN=BCL-2 (length=711 residues).
atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatccattataagctgtcacagagggg
ctacgagtgggatactggagatgaagactccgcgcccctgagggctgcccccacccctggcatcttctccttccagcctg
agagcaaccggacgcccgctgtgcaccgagacacggctgccaggacgtcgcctctacggccccttgtcgccaccgctggg
cctgcgctcagccctgtgccacctgtggtccacctgaccctccgccgggctggggatgacttctctcgtcgctaccgtcg
cgactttgcagagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggaac
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcacccctggtggacaacatcgctctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggataacggaggctgggatgcctttgtggaactatatggccccagcatgcgacctctgtttgatttctcctggctgtctc
tgaagacgctgctcagcctggccctggtgggggcctgcatcactctgggtgcatacctgggccacaagtga
>gnl|bcl2dbcds|G3V977_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2A1 (length=528 residues).
atgacagactgtgagttcatgtatatccactccctggctgagaactatcttcagtatgtcctgcaggtacctgcctttga
atcggctccaagcaaaacgtccagagtgctacagagagttgctttctctgtacaaaaggaagttgaaaagaatctgaagc
catacttggatgactttcacgtggaatccatagatactgccagaataatattcaaccaagtgatggaaaaagaatttgaa
gatggcatcattaactggggaaggattgtgactatatttgcctttgggggtgttctcctgaaaaagcttccacaagagca
gattgccctggatgtggatacttacaagcaagtttccagttttgtggcggaattcataatgaataacacaggagaatgga
tacagcagaatggaggctgggaagatggcttcacaaagaagtttgaacctaaatctggctggctgacttttctgcagatg
acagggaagatctgggaaatgctctttctcctcaagcaacactactga
>gnl|bcl2dbcds|O88996_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcaaccccagacacacgggctctagtggctgactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggccctggggaaggcccagcagccgacccgctgcaccaagccatgcgggcagctggagacgagtttg
agacccgcttccggcgcaccttctctgacctggccgctcagctacacgtgaccccaggctcagcccagcaacgcttcacc
caggtttccgacgaacttttccaagggggccccaactggggccgtcttgtggcattctttgtctttggggctgccctgtg
tgctgagagtgtcaacaaagaaatggagccattggtgggacaagtgcaggattggatggtgacctacctggagacacgct
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcacgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|P49950_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Rattus norvegicus GN=BCL-2 (length=711 residues).
atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatccattataagctgtcacagagggg
ctacgagtgggatactggagatgaagactccgcgcccctgagggctgcccccacccctggcatcttctccttccagcctg
agagcaaccgaacgcccgctgtgcaccgagacacggctgccaggacgtcgcctctacggccccttgtcgccaacgctggg
cctgcgctcagccctgtgccacctgtggtccacctgaccctccgccgggctggggatgacttctctcgtcgctaccgtcg
cgactttgcagagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggaac
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggggagcgtcaac
agggagatgtcacccctggtggacaacatcgctctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggataacggaggctgggatgcctttgtggaactatatggccccagcatgcgacctctgtttgatttctcctggctgtctc
tgaagacgctgctcagcctggccctggtgggggcctgcatcactctgggtgcatacctgggccacaagtga
>gnl|bcl2dbcds|Q7TS60_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2L2 (length=660 residues).
atgtccctttttggtctctgtcaatatttttcatatatttatgtcagtctgtcatccttgcccctttcagccgcccggat
ggcgaccccagcctcaaccccagacacacgggctctagtggctgactttgtaggctataagctgaggcagaagggttatg
tctgtggagctggccctggggaaggcccagcagccgacccgctgcaccaagccatgcgggcagctggagacgagtttgag
acccgcttccggcgcaccttctctgacctggccgctcagctacacgtgaccccaggctcagcccagcaacgcttcaccca
ggtttccgacgaacttttccaagggggccccaactggggccgtcttgtggcattctttgtctttggggctgccctgtgtg
ctgagagtgtcaacaaagaaatggagccattggtgggacaagtgcaggattggatggtgacctacctggagacacgcttg
gctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcacggcg
tctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaactgtagggg
ccttttttgctagcaagtga
>gnl|bcl2dbcds|Q7TS62_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2L1 (length=855 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
tagcgatgtcgaagagaacaggactgaagccccagaagaaactgaaccagaaagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagccccgcggtgaatggagccactggccacagcagcagtttggatgcgcgggaggta
atccccatggcagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcggtaccggagagcattcagtga
tctaacatcccagcttcatataaccccagggacagcatatcagagctttgaacaggtagtgaatgaactctttcgggatg
gggtaaactggggtcgcattgtggccttcttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggtaagaaccacgccccttgtgtgtccgccccttgtgtgtctctcctctgtggagatccctaactgccctttttggt
ctcctggcatggttgttgaagatatcgattattcaggagacattcctggcttcactttaataccaggggttaactttggg
aatattgatgaccctgtttttaaggaacctgtatttttcattctggctacccttgtggccccgcagtttcatagttttgt
tccaatttctcggcaaagaaaaacagcctgtgtgtttacttggcttaaaacctag
>gnl|bcl2dbcds|Q7TS62_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
tagcgatgtcgaagagaacaggactgaagccccagaagaaactgaaccagaaagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagccccgcggtgaatggagccactggccacagcagcagtttggatgcgcgggaggta
atccccatggcagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcggtaccggagagcattcagtga
tctaacatcccagcttcatataaccccagggacagcatatcagagctttgaacaggtagtgaatgaactctttcgggatg
gggtaaactggggtcgcattgtggccttcttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggatctctacgggaacaatgcagcagccgagagccggaaaggccaggagcgtttcaaccgctggt
tcctgacgggcatgactgtggctggtgtagttctgctgggctcactcttcagtcggaagtga
>gnl|bcl2dbcds|Q7TS62_BCL2L1-04 BCL2-like 1 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2L1 (length=699 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
tagcgatgtcgaagagaacaggactgaagccccagaagaaactgaaccagaaagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagccccgcggtgaatggagccactggccacagcagcagtttggatgcgcgggaggta
atccccatggcagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcggtaccggagagcattcagtga
tctaacatcccagcttcatataaccccagggacagcatatcagagctttgaacaggtagtgaatgaactctttcgggatg
gggtaaactggggtcgcattgtggccttcttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggtaagaaccacgccccttgtgtgtccgccccttgtgtgtctctcctctgtggagatccctaactgccctttttggt
ctcctggcatggttgttgaagatatcgattattcaggagacattcctggctcactttaa
>gnl|bcl2dbcds|Q7TS62_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2L1 (length=855 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
tagcgatgtcgaagagaacaggactgaagccccagaagaaactgaaccagaaagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagccccgcggtgaatggagccactggccacagcagcagtttggatgcgcgggaggta
atccccatggcagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcggtaccggagagcattcagtga
tctaacatcccagcttcatataaccccagggacagcatatcagagctttgaacaggtagtgaatgaactctttcgggatg
gggtaaactggggtcgcattgtggccttcttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggtaagaaccacgccccttgtgtgtccgccccttgtgtgtctctcctctgtggagatccctaactgccctttttggt
ctcctggcatggttgttgaagatatcgattattcaggagacattcctggcttcactttaataccaggggttaactttggg
aatattgatgaccctgtttttaaggaacctgtatttttcattctggctacccttgtggccccgcagtttcatagttttgt
tccaatttctcggcaaagaaaaacagcctgtgtgtttacttggcttaaaacctag
>gnl|bcl2dbcds|Q7TSN8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Rattus norvegicus GN=BCL-2 (length=711 residues).
atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatacattataagctgtcacagagggg
ctacgagtgggatgctggagatgcggacgcggcgcccctgggggctgcccccacccctggcatcttctccttccagcctg
agagcaacccaatgcccgctgtgcaccgggacatggctgccaggacgtctcctctcaggcccctcgttgccaccgctggg
cctgcgctcagccctgtgccacctgtggtccatctgaccctccgccgggctggggatgacttctctcgtcgctaccgtcg
tgacttcgcagagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggaac
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcacccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggataacggaggctgggatgcctttgtggaactatatggccccagcatgcgacctctgtttgatttctcctggctgtctc
tgaagaccctgctcagcctggccctggtcggggcctgcatcactctgggtgcatacctgggccacaagtga
>gnl|bcl2dbcds|Q925A9_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2A1 (length=528 residues).
atgacagactgtgagttcatgtatatccactccctggctgagaactatcttcagtatgtcctgcaggtacctgcctttga
atcggctccaagcaaaacgtccagagtgctacagagagttgctttctctgtacaaaaggaagttgaaaagaatctgaagc
catacttggatgactttcacgtggaatccatagatactgccagaataatattcaaccaagtgatggaaaaagaatttgaa
gatggcatcattaactggggaaggattgtgactatatttgcctttgggggtgttctcctgaaaaagcttccacaagagca
gattggcctggatgtggatacttacaagcaagtttccagttttgtggcggaattcataatgaataacacaggagaatgga
tacagcagaatggaggctgggaagatggcttcacaaagaagtttgaacctaaatctggctggctgacttttctgcagatg
acagggaagatctgggaaatgctctttctcctcaagcaacactactga
>gnl|bcl2dbcds|Q99M66_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2L10 (length=558 residues).
atgggtgacccgctgcaggatcgcactagacggctgctgactgactacatattgttctgcgcacgggcgccgaacacccc
tgagccactgcccacgtctgttgaggcggccttgctgcgctctgtgactagtcagatccaacaggagcaccaggatcttt
tcaactccttccgcgactaccagggcaaccgcctggagctggtgacacagatggcggatgagttgctctccaatgaccaa
gagttcaactggggccgcctggtgatgctcctggccttcgtggggacgctaatgaaccaagacaggactgttaagcggag
gagggatcaaagaaaccgtctcctactggagcgagactgctatctcatagtgagcttgctgtacaatcgactcacaggac
ggcatcgctcctggctggaggctcacggtggctgggatggcttttgccaattcttcaagaaccccttaccacccggcttc
tggagaagattgctgatccgggctattctgtcctgtttctttgcaacggccatcttttatatctggaaatgtttataa
>gnl|bcl2dbcds|Q9Z1P3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rattus norvegicus GN=MCL-1 (length=993 residues).
atgtttggccttcggagaaacgcggtaatcggcttgaacctgtactgcggcggcgctagcctcggcgcgggcggcggctc
tccggccgggacgcgcctggcggccgaggaggccaaggcgcggcgcgaggggggaggggaggccgctctgctgcccggcg
cgcgggtggtcgcccggccgcctccggtgggcgccgaggaccccgacgtcaccgcgtcggcagagaggcggctgctcaag
tcgcccggcctcctcgccgtgccgcctgaggagatggccgcgtcggccgccgccatcatgtctcccgaggaggagctgga
cggctgtgagccggaggtgctcagcaaacgcccggcggtgctgcccctactggagcgcgtgagcgaggcggctaagagct
ccggagctgacggctcgctgccctccacgccgccgccgcctgaggaggaagacgacgagctgtaccaccagtcgctggag
atcatctcccgctacctgcgggagcaggcgacgggctccaaggacgcgaagcctctgggcgaggccggcgcagcgggccg
gagggcgctggagaccctgcggcgcgtgggcgacggcgtgcagcgcaaccacgagacggccttccagggcatgcttcgga
aactggacattaaaaacgaggacgatgttaaatctttttctcgagtgatgacccatgttttcaaagatggcgtaacaaac
tggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttaaagagcataaaccaagaaagctgcat
cgaacctttagcagaaagtatcacagacgttcttgtaaggacgaagcgggactggcttgtgaaacaaagaggctgggatg
ggtttgtggagttcttccacgtacaggacctagaaggcggcatcagaaatgtgctgctggcttttgcgggtgttgctgga
gtaggggctggtctggcatatctaataaggtag
>gnl|bcl2dbcds|A0A2K6KHG1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Rhinopithecus bieti GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ttggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A2K6KRW9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rhinopithecus bieti GN=MCL-1 (length=1053 residues).
atgtttggcttcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcgaaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgggacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
tcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagctccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcactggaaattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggtgggggatggcgtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttatctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagttgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2K6KRW9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rhinopithecus bieti GN=MCL-1 (length=816 residues).
atgtttggcttcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcgaaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgggacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
tcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagctccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcactggaaattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggtgggggatggcgtgcagcgcaaccacgagacggctttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2K6KRW9_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rhinopithecus bieti GN=MCL-1 (length=594 residues).
atgtttggcttcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggtgggggatggcgtgcagcgcaaccacgagacggctttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttatctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagttgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K6LPM4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Rhinopithecus bieti GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K6LPM4_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Rhinopithecus bieti GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttatctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K6LV22_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Rhinopithecus bieti GN=BCL2A1 (length=492 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtacgtcctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccagaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggggaaatggcacaatcacatgcctatgctagtagagtcagtggcccataggaagaagaaa
atggctttgtaa
>gnl|bcl2dbcds|A0A2K6LV22_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Rhinopithecus bieti GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtacgtcctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccagaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctatctctcctgaagcaatactgttga
>gnl|bcl2dbcds|A0A2K6M5H5_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Rhinopithecus bieti GN=BCL2L10 (length=615 residues).
atggctgacccgttgcgggagcgcaccaccgtggctgacccgttgcgcgagcgcaccgagcggttgctggccgactatct
ggggtgctgcgcccgggaacccggcacccccgagccgaggccgtccacgcccgaggccgccgtgctgcgctccgcggcgg
ccaggttacggcagctccaccggtccttcttctctgcctacctcggctaccccgggaaccgcgtcgagctggtggcgctg
atggcggaggccgtgctctccgacagccccggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgct
gctggagagagagccgctggtgacagcctggtggaagaagcggagcttccagccgcggctgaaggagcaggagggcgacg
tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcacggggcagcaccgcgcctggcttcaggctcag
ggcggctgggatggcttttgtcacttcttcaggaccccctttccgctggctttttggagaaaactgctgatccaggcttt
cctggcatgcttgttaacaacagccttcggttacctctggacacgattattatga
>gnl|bcl2dbcds|A0A2K6MEE6_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Rhinopithecus bieti GN=BCL2L2 (length=972 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcgcagcaacgcttcacc
caggtctctgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
gggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
gcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctacc
gcgcccggaccaccaactacaacagttcccgctctcgcttctacagtggttttaacagcaggccccggggtcgcgtctac
aggtcaggatag
>gnl|bcl2dbcds|A0A2K6MEE6_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Rhinopithecus bieti GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcgcagcaacgcttcacc
caggtctctgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A2K6PHG5_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtacgtcctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccagaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctatctctcctgaagcaatactgttga
>gnl|bcl2dbcds|A0A2K6PHG5_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL2A1 (length=492 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtacgtcctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccagaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggggaaatggcacaatcacatgcctatgctagtagagtcagtggcccacaagaagaagaaa
atggctttgtaa
>gnl|bcl2dbcds|A0A2K6PPL1_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rhinopithecus roxellana GN=MCL-1 (length=594 residues).
atgtttggcttcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggtgggggatggcgtgcagcgcaaccacgagacggctttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttatctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagttgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K6PPL1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rhinopithecus roxellana GN=MCL-1 (length=1053 residues).
atgtttggcttcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcgaaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgggacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
tcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagctccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcactggaaattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggtgggggatggcgtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttatctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagttgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2K6PPL1_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rhinopithecus roxellana GN=MCL-1 (length=816 residues).
atgtttggcttcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcgaaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgggacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
tcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagctccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcactggaaattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggtgggggatggcgtgcagcgcaaccacgagacggctttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2K6QFA2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K6QFA2_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttatctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K6QFA2_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K6R2I6_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL-2 (length=627 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ttggatccaggataacggaggctggcgtacaatgtgcacgtggtgccgcttcaggggatgtgattga
>gnl|bcl2dbcds|A0A2K6R2I6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ttggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A2K6R5T5_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL2L10 (length=696 residues).
atggctgacccgttgcgcgagcgcaccgagcggttgctggccgactatctggggtgctgcgcccgggaacccggcacccc
cgagccgaggccgtccacgcccgaggccgccgtgctgcgctccgcggcggccaggttacggcagctccaccggtccttct
tctctgcctacctcggctaccccgggaaccgcgtcgagctggtggcgctgatggcggaggccgtgctctccgacagcccc
ggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgctggtgacagcctg
gtggaagaagcggagcttccagccgcggctgaaggagcaggagggcgaggtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcggctcacggggcagcaccgcgcctggcttcaggctcagggcggctgggtgagcacgcggcggacaccg
ggacgcggggcgggacgggcatccgggaagcgcccacgaggccggcacggatggcttttgtcacttcttcaggaccccct
ttccgctggctttttggagaaaactgctgatccaggctttcctggcatgcttgttaacaacagccttcggttacctctgg
acacgattattatgagttttaaaatttttaacccacttctacctgcccaactgtga
>gnl|bcl2dbcds|A0A2K6RW46_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttttaggttataagctgaggcagaagggtta
tgtctgtggagctggccctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcgcagcaacgcttcacc
caggtctctgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A2K6RW46_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttttaggttataagctgaggcagaagggtta
tgtctgtggagctggccctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcgcagcaacgcttcacc
caggtctctgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A2K6RW46_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL2L2 (length=972 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttttaggttataagctgaggcagaagggtta
tgtctgtggagctggccctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcgcagcaacgcttcacc
caggtctctgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
gggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
gcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctacc
gcgcccggaccaccaactacaacagttcccgctctcgcttctacagtggttttaacagcaggccccggggtcgcgtctac
aggtcaggatag
>gnl|bcl2dbcds|A0A2K6TIT7_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L10 (length=687 residues).
atggctgacccgctgcagcagcgcaccgagcagctggtggcggactacctggagtactgctcccgggagcccggcacccc
cgagtcgccaccggccacggccgaggccgctgtgctgcgcgccacggccgccgttgtacggaaactctacccgtccttct
tctccgcttaccgcggctaccccaggaaccgcgtcgagctggtggcgaggatggcggaggccttgctctccgacagtccc
ggtcccacctggggcaacgtggtgatgctcctggccttcgcggggacgctgctagagagggggccgctggtgaccgcccg
gtggaagaagtggggcttccagtcgcggttgaaggagccggagggcgacgtcgcccgggactgccagcgcctggtgggct
tgctgagctcgcggctcgtggggcagcaccgtgcctggctggaggctcagggcggctgggtgagcacgcggaggaggacg
tggggcgggatgggcacctgggaagggcccgccaggtggggtatttttctcctgtgcctattaaatgacctcctactcgc
tggcatggagaaaactgctggtcccggttttcctgtcatggttgttaacagcagcattcatctacttctggacacgataa
ttaggagttttaaaatttttagcccacttctgcctgcccaactgtga
>gnl|bcl2dbcds|A0A2K6TLM0_BCL2A1-03 BCL2-related protein A1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2A1 (length=489 residues).
atgacagaccacgaatttggatatattcacaatctaactcaggactatctgcggtatgtcctgcagataccacaatctgg
aacgggtccaagcaaaacgtccagagtactacaaaaggttgcattctcagtccaaaaggaagtggaagagagtctgaagc
catgcttggacaacgttcatattgtgtccatggacaatgccagaacaatattcagtcaagtgatggaaaaggaatttgaa
gatggcattattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgagagcg
aattgccccggatgtggatacttacaaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taagacgaaacggaggctgggggaaatggaacagtctcatgcttatgctagtggagtcagcgcagaagaagaagaaaatg
gctttgtaa
>gnl|bcl2dbcds|A0A2K6TLM0_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2A1 (length=528 residues).
atgacagaccacgaatttggatatattcacaatctaactcaggactatctgcggtatgtcctgcagataccacaatctgg
aacgggtccaagcaaaacgtccagagtactacaaaaggttgcattctcagtccaaaaggaagtggaagagagtctgaagc
catgcttggacaacgttcatattgtgtccatggacaatgccagaacaatattcagtcaagtgatggaaaaggaatttgaa
gatggcattattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgagagcg
aattgccccggatgtggatacttacaaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taagacgaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctatctctcttgaagcaatactactga
>gnl|bcl2dbcds|A0A2K6TLM0_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2A1 (length=435 residues).
atgacagaccacgaatttggatatattcacaatctaactcaggactatctgcggtatgtcctgcagataccacaatctgg
aacgggtccaagcaaaacgtccagagtactacaaaaggttgcattctcagtccaaaaggaagtggaagagagtctgaagc
catgcttggacaacgttcatattgtgtccatggacaatgccagaacaatattcagtcaagtgatggaaaaggaatttgaa
gatggcattattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgagagcg
aattgccccggatgtggatacttacaaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taagacgaaacggaggctgggacctatcgcaatag
>gnl|bcl2dbcds|A0A2K6TM77_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaacttttccaagggggtcccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacaggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A2K6TM77_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L2 (length=615 residues).
catctttcatccttgcctcttatagccgcccggatggcgaccccagcctcagccccagacacacgggctctggtggcaga
ctttgtaggttataagctgaggcagaagggttatgtctgtggagctggccccggggagggcccagcagctgacccgctgc
accaagcaatgcgggcagctggagatgagttcgagacccgcttccggcgcaccttctctgatctggcggctcagctgcat
gtgaccccaggctcagcccaacaacgcttcacccaggtctccgatgaacttttccaagggggtcccaactggggccgcct
tgtagccttctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgc
aggagtggatggtggcctacctggagacgcggctggccgactggatccacagcagtgggggctgggcggagttcacagct
ctatacggggacggggccctggaggaggcgcggcgtctgcgggaggggaactgggcatcagtgaggacagtgctgacagg
ggccgtggcactgggggccctggtaactgtaggggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A2K6TM77_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L2 (length=1041 residues).
atggcgaccccagcctcagccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaacttttccaagggggtcccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggccgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggaactacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggaccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagacgagtccctatttagaggacg
gcaaatcaaggttgactttaaggctttcatttattcatctctgactcaggtgatcccaaaacgaaccaacagaccaggca
tcagcacaacagaccggggttttccacgagcccgctaccgcgcacggaccaccaactacaacagttcccgctctcgattc
tacagtggttttaacagcaggccccggggtcgcgtctacaggggccgggctagagcgacatcatggtattccccttacta
a
>gnl|bcl2dbcds|A0A2K6UEL3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagatgtgggcgccgcgcccccaggcgccgcccccgcgccgggcatcttctcctcccagcccg
ggcacacgcccggtcccgctgcgccccgggaccctgtcgccaggaccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnncagcccagtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccgccg
ctatcgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgaccgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggaactgtatggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagcttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A2K6UWY8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccagcctggcacctggcggacagccccgcggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcaataaagcaagcactgagggaggcaggcgacgagtttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcgtatcaaagctttgaacaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaa
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcagcagccgagagcagaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|A0A2K6UWY8_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L1 (length=441 residues).
atgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatgctccacat
cacccccgggacagcgtatcaaagctttgaacaggtagtgaacgaactcttccgggatggggtgaactggggtcgcattg
tggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaagtattggtgagtcggatcgca
gcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaact
ctatggaaacaatgcagcagccgagagcagaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtgg
ccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|A0A2K6V5Y3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=MCL-1 (length=1053 residues).
atgttcggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccccccgggagggcggcttctggccgcggagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgctagccctccggccgccctgacgcctgacgcccggagggtcgtgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgcc
gctggaggagatggaagccccggccgccgacgccatcatgtcgcccgaagacgagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagctggtcggggagcctggtcatggctccagtacggacgggtcactc
ccctcgacgccgccgcccgcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtacctccg
ggagcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagcaggaaggcgctggagaccctgc
ggcgggtcggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggtaggattgtgactct
catttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgcattgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggatctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2K6V5Y3_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=MCL-1 (length=813 residues).
atgttcggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccccccgggagggcggcttctggccgcggagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgctagccctccggccgccctgacgcctgacgcccggagggtcgtgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgcc
gctggaggagatggaagccccggccgccgacgccatcatgtcgcccgaagacgagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagctggtcggggagcctggtcatggctccagtacggacgggtcactc
ccctcgacgccgccgcccgcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtacctccg
ggagcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagcaggaaggcgctggagaccctgc
ggcgggtcggggacggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
tctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttgtaa
>gnl|bcl2dbcds|A0A2K6V5Y3_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=MCL-1 (length=594 residues).
atgttcggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccccccgggagggcggcttctggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagca
ggaaggcgctggagaccctgcggcgggtcggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggtaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgca
ttgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggatctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|E2IV77_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Saimiri boliviensis GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccagcctggcacctggcggacagccccgcggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcaataaagcaagcactgagggaggcaggcgacgagtttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcgtatcaaagctttgaacaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaa
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcagcagccgagagcagaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|B5XAY3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Salmo salar GN=BCL2L1 (length=687 residues).
atgatgacttacaacaacagagaactggtggtgtactatattacctataaactatcacagagggactaccccttcaacca
catggagctcacggaagcccagaatcggactgaggtgggacaggtggaagggggtgcggcagtcctaacatacgtcaacg
ggacgagtcccgggactccaccaccacggcagtcgcccccctcctcccctcggcggacagcgggcctggacgcagtgaaa
gaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagcgttcagtgacctgtcctcccagctacacat
cacgccgtccacagcctaccagagctttgagaacgtgatggacgaggtgttccgggacggtgtcaactggggacgggtgg
tgggcctgttttccttcggaggggccctctgtgtagaatgtgtggacaaggagatgaaccccttggtgggaaggatcaca
gactggatgaccgtctacctggacaaccacatccagccctggatccagagccaaggaggatgggaccggtttgcagagat
ctttggaatggacgctgcagccgagagcaggaagtctcaggagagctttaagaagtggcttctggcagggatgaccctgg
tcacaggagtcgtcgtagggtcactcttcgctcagaaacgcctgtga
>gnl|bcl2dbcds|C0HAD8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Salmo salar GN=BCL2L1 (length=651 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctatagactgtcccagaggaattattcatgttgtcaatt
ggggctggagggtgcaagtggacggactgagggagatgacgccattgcaaatgggtctgtggggaacagcagaagcaatt
tggcgaagccctcatctccacaggggggcatggagccagtgaaagcagcactacgggactcagtggatgagtttgagctg
cgctacacccgcgccttcagtgacctctcctcccagctccacatcacccctgccacagcctaccacagctttgagagtgt
gatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggtctgtttgctttcggcggggccttgtgtgttg
agtgtgttgagaaggatatgagcccactggtggcgcgcatcgcagactggatgaccacctacctggacaaccatatccag
ccctggatccagagccaaggaggatgggaccgttttgcagagatctttggcagagatgctgctgcagacgttcgacggtc
tcaggagagcataattaaatggctgctagttggggtgattctgctttcaggagtgctggtcggcactctcatcatgaaga
aacgccagtga
>gnl|bcl2dbcds|Q0KFR9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Salmo salar GN=MCL-1 (length=858 residues).
atgagyctgtcgaactcgattacacgagccacaactacgatgttgcattttcaaaatggaggatcttcgtacctagctga
tgatgctaggccgttgtactatttccagggggctggggccatatgtgctggggcgtcaccgaagtctaaagtggacttgg
gaaatgggactggcgatactccaccacgacccacgacgttaggagtgaatgtcgtgaaaagcaacggccttgataatcat
ttgtctgaccgaagcaacaatgacgactctttgccgtgcactccccagatggcgtcagaatgtgggcctgaactatcgaa
ttgtccatcgggcgatgaagtattggaacatgataccagacaactcattgagaattttttgggggactacacaggactgt
ctcagcctcgatggacgcaaagcaagcctcttacgacgatgaagcgagtggtggaggacgtaatagcaaagcaccgatac
gcatacaatggtatggtcgccaaacttgacttggatgaccgatgcgatgacatgggcgtcatcaattctgtggccaagac
catgttcagtgacgggatcacaaactggggtcgcatcgccagcctggtggcatttggagcagtggtgagccagcacctga
aggagaggggcaggggacactgcgttgagttggtgggccaagagattgccaaatacctcctctctgaccaaagtgactgg
ctgatcaaaaacaatgcttggaatggatttgtagagttctttcatgtacaagatcctgagtcctcagtaaggaacaccct
cctagcctttgctggagttgctggaattggggcaacactcgccatgttcatcaggtga
>gnl|bcl2dbcds|G3WBC5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sarcophilus harrisii GN=MCL-1 (length=789 residues).
gacgtcaccgccccgccgagaccgttctttttcgcgccgggcggccgctgctcgccccccgccgaggtggccgatggagc
cgcggacgccatcctatcccccgaggacgagctggacggttacgagcccgagctccccgggaagcggcccgctcgcctgg
ccatgctgcccttggccagagagggtggggacacatcgagcaatgcccgcggctcactgccctcaacgccgcccccggcc
gaggaggacgaggacgaggaggaggatgagttgtacgggcagtccttggagttgataacccgatacctccgcgagcaggc
ggtcggcaccaaggacaccaagcccctacgcagtgggaaggcactggagaccctgcggcgcgtgggagacggtgtccaga
ggaaccacgagacggctttccaaggtatgcttcgcaaactggatatcaagaacgaagaggacattaaggccgtgtctcgc
gtggtaactcatgtgttcagtgacggggtgacgaattggggcagaattgtgactctcatttctttcggggcctttgtggc
aaagcacttgaagagcataaaccaggaaagttgcatagacccgctagcagaaagcataacagatgtcctggttaaatcga
aaagggactggctgatgaagcagaagggctgggaggggtttgtggaattctttcatgtagaggacctagaaggtggcatc
agaaatgtgctgctcgcctttgccggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|G3WKX6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sarcophilus harrisii GN=BCL2L1 (length=684 residues).
atgtctcacagtaaccgggagctggtggttgactttctttcttacaagctttcacagaagggatacaattggagtcagtt
tgaagatgagaacaggactgaggcctcagaagggacagagatacctagtactgtgaatggcagcccctcttggcaccctg
ctgacagccgtgcagtgagtggggccacaggacacagcagcagcctggatgcccatgagacaattcctgtagctgctgtg
aagcaagctttgagggaggcaggagatgaatttgaactccggtaccggcgggcattcagtgatctgacatcccagctcca
catcactccagggacggcttatcagagttttgagcaggtagtgaatgaactcttccgggatggggtgaactggggccgaa
ttgtggcattcttctccttcggaggggcattgtgtgtggaaagcgtggataaagagatggaagtcttggtagcacgcatc
acctcctggatggccacttacttggatgagcacctagacccatggatccaagaaaatggcggttgggacaccttcgtgga
gctttatgggaatgatgcagcagcagagagccggaagggccaggaacgcttcaacagatggctgctgactggcatgacag
tggctggtgtagtcctgctggggtccctgttcagccggaagtga
>gnl|bcl2dbcds|G3WPT2_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Sarcophilus harrisii GN=BCL2L2 (length=582 residues).
atggcgactccagcctcagccccagatactcgagccctggtggcagattttgtgggttataagctaaggcagaagggcta
tgcctgtggaactggcccaggagagggccctacaaatgagcctctgcaccgggccatgcgagccgctggagatgagtttg
agtcccgtttccgacgcacattttctgatctggctgctcagttgcatgtgactcctggctcagcccagcagcgctttacc
caggtctcagatgagctcttccaggggggggccaactggggccgtcttgtggcattcttcgtctttggggcagcgctctg
tgcagagagcgtcaacaaagagatggagccactggtgggacaggttcaggattggatggtgacctacctagagacacagc
tggcagactggatccacagcagcgggggctgggcggaattcacggctctgtacggggatggggccctggaggaggcaagg
cgtctgcgggaggggaactgggcctcagtgcgtacagtgctaacaggggctgtggcactgggggctctggtgactgtggg
ggccttctttgccagcaagtga
>gnl|bcl2dbcds|G3WPT2_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Sarcophilus harrisii GN=BCL2L2 (length=630 residues).
catagctcaagccccattttcttctctctgccttttatagccagccagatggcgactccagcctcagccccagatactcg
agccctggtggcagattttgtgggttataagctaaggcagaagggctatgcctgtggaactggcccaggagagggcccta
caaatgagcctctgcaccgggccatgcgagccgctggagatgagtttgagtcccgtttccgacgcacattttctgatctg
gctgctcagttgcatgtgactcctggctcagcccagcagcgctttacccaggtctcagatgagctcttccaggggggggc
caactggggccgtcttgtggcattcttcgtctttggggcagcgctctgtgcagagagcgtcaacaaagagatggagccac
tggtgggacaagaaaaaagatatggggtgcacttgaagcagggaattttagcaaggtatttaccaagcaaggctggagct
gcggaattcacggctctgtacggggatggggccctggaggaggcaaggcgtctgcgggaggggaactgggcctcagtgcg
tacagtgctaacaggggctgtggcactgggggctctggtgactgtgggggccttctttgccagcaagtga
>gnl|bcl2dbcds|G3WSP8_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Sarcophilus harrisii GN=BCL2A1 (length=519 residues).
atggctgattgtgaattccattatgttcacatgctagcccaggactacttgaagcatgttcaacaaatgccacgactggg
atcatgtctacataggacatctcaaatacttcaaaaagttgctttctctgtccaagaagaagttgaaaaggatatggaaa
cattcttgagcactttggacattacttctgtagattgtgccagaagaattttcaacagtgttatggaaaaggaatttgag
gatggcatcatcaactggggacggattgtcaccatatttgcttttgggggaattctcattaagaaacttctgagacacag
agctccactgactatggacactcatgaagaaatttctcattttattgctgagttcataatgaacaacatagcagaatgga
taagacaaaatggaggatgggaaaatggcttcataaagaactttgaacccaatatggtatggccaaacttcacagatatt
tcaacaaagatctggaatgtattttcctttctgaagtaa
>gnl|bcl2dbcds|G3WZW9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sarcophilus harrisii GN=BCL-2 (length=684 residues).
atggctcaccctggaagaagaggatatgataaccgggaaatagtgatgaaatacattcattataagctatcacagagagg
gtacgagtgggatgctggaaatctgaggacaccagcctctccaagtcttcctcctgttgttgcttctgcccctgctgttg
gaatcttctctaaccagccaagacatacacctctgcctgctgcaccccaggacttggccacttctactactgctgctgct
agaaactcacctttgcctcctcctcctgctgttgctgctgctactgttgctgctggaccagctgtcagtccagtgccacc
tgtggtccacctgactcttcgtcaagctggagatgatttctctcgaagatatcgaagagatttcgatgaaatgtcaggtc
agctgcacctgacccctgttactgctaggggacgctttgccacagtagtggaagagctgttcagggatggggtgaactgg
gggcggattgtggccttctttgaatttggtggtgttatgtgtgtggagagcgtcaaccgggagatgtcgcctctggtgga
cagcatagccctgtggatgactgagtacctgaaccggcacctgcacaactggatccaggataacggaggatggggtacca
aagcaatttgcatgggcaccagtggtccatttcaggtaagttaa
>gnl|bcl2dbcds|G3WZW9_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sarcophilus harrisii GN=BCL-2 (length=498 residues).
ccatttggctgctctccttggtgttcactgctctctcctttgggaataatggctcaccctggaagaagaggatatgataa
ccgggaaatagtgatgaaatacattcattataagctatcacagagagggtacgatgttgctgctggaccagctgtcagtc
cagtgccacctgtggtccacctgactcttcgtcaagctggagatgatttctctcgaagatatcgaagagatttcgatgaa
atgtcaggtcagctgcacctgacccctgttactgctaggggacgctttgccacagtagtggaagagctgttcagggatgg
ggtgaactgggggcggattgtggccttctttgaatttggtggtgttatgtgtgtggagagcgtcaaccgggagatgtcgc
ctctggtggacagcatagccctgtggatgactgagtacctgaaccggcacctgcacaactggatccaggataacggagga
tgggtaggtgtttcggct
>gnl|bcl2dbcds|A0A0B4KJI5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sparus aurata GN=BCL2L1 (length=648 residues).
atgtcgtacagtaacagagagctagtggagtcctttttaagctacaaactgtctcagaggaactatccaactgccctgct
gaggccagatgatgctggtggaaggactgaggcagacaaagccaactcagctgccacaaatggcctgctggccaacagca
gcaacgggggcggacagccaggtgctgacatagaggctgttaaagcagctcttcgggactcatctgaagagtttgaactg
ctcttcacacaagcgtttagtgacctctccacgcagctcgacatcactcctgacacagcctaccacagctttaagagcgt
gatggacgaggtgttcaaggacggagtcaactggggacgtgtagtgggcctgtttgcttttggcggtgtgctgtgtgtgg
aatgcgttgagaaggatacgagcgagctggtctcccgcatcgcagactggatgaccatgtacctggatgagcacatcaat
ccgtggattgagagccaaggaggatgggactcctttgctgaggtttttgggcgagacgcagctgcagaagcgaggagatc
tcgggagactctgagtcggtggctgctggttggagtggcgctgctaatgggagttgtgctcggtgtcctcatcgctaaga
aacagtga
>gnl|bcl2dbcds|A0A287APJ6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sus scrofa GN=BCL-2 (length=1014 residues).
atgctgctgctggctgccgccttcctcgtggcgttcgtgctgctgctctacatggtgtctccgctcatcagccccaagcc
cctcgccctgcccggagctcatgtggtggttactggaggctccagcggcatcggaaagtgcattgccattgagtgctata
aacaaggagcgtttataactctggttgcacgaaatgaggacaagctgttgcaggcaaagaaagaaattgaaaaacactct
attaatgataaacaggtggtgctttgtatatcagttgatgtgtctcaagactatagccaagtagagaatgtcataaaaca
agcacaggagaaactgggcccagtggacatgcttgtaaactgtgcaggaatgtcactttcaggaaaatttgaagatcttg
aagttagtacttttgagaggctcatgagtgtcaactacctgggcagcgtgtacccgagccgagcggtgatcaccaccatg
aaggagcgccgcgtgggcaggatcgtcttcgtgtcctctcaggccgggcagctgggcctgttcggcttcacagcctactc
ttcctcaaagtttgccatcaggggattggcagaagctctgcagatggaggtgaagccatataatgtttatgtcacagtgg
cctaccctccagacacagacacccctgggtttgccgaagaaaacaaaaccaagcctttggagactcgtcttatttcagag
accacatctgtttgcaaaccagagcaagtggccaaacaaattgttaaagatgccatacaaggaaatttcaatagttccat
cggctcagatgggtacatgctgtcctccctgacctgtggaatggctccagtaacttccatcactgaagggctccagcagg
atgcctttgtggagctgtatgggcccagcatgcggcctctatttgatttctcctggctgtctctgaaggcgctgctcagt
ctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A287APJ6_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sus scrofa GN=BCL-2 (length=717 residues).
atggcgcacgctgggagaacagggtatgataaccgggaaatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcgggcgccgcgtccccgggggccgctcccgcaccgggcatcttctcctcccagcccg
ggcgaacccccgctcccgccaggacctcgccgccgccgaccccgaccgcccccgccgccaccgccgccgccgccgccgcc
gcggggcctgtactcagcccggtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctctcgtcgcta
ccgccgcgactttgccgagatgtccagccagctgcacctgactcccttcaccgcgaggggacgctttgccacggtggtgg
aggagctcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagc
gtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctg
gatccaggataacggaggctgggatgcctttgtggagctgtatgggcccagcatgcggcctctatttgatttctcctggc
tgtctctgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A287AW74_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Sus scrofa GN=BCL2L2 (length=582 residues).
atggcgaccccggcctcagccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccagcagcgcttcacc
caggtctctgatgaactcttccaaggaggccccaactggggccgccttgtggccttctttgtcttcggagctgcactgtg
tgctgagagtgtcaataaggagatggagccactcgtgggacaagtgcaggagtggatggtgacctacctggagacacggc
tggccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A287AW74_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Sus scrofa GN=BCL2L2 (length=1002 residues).
atggcgaccccggcctcagccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccagcagcgcttcacc
caggtctctgatgaactcttccaaggaggccccaactggggccgccttgtggccttctttgtcttcggagctgcactgtg
tgctgagagtgtcaataaggagatggagccactcgtgggacaagtgcaggagtggatggtgacctacctggagacacggc
tggccgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaagtagagaagcagatgaatatgagtccaccaccaggcaatgctggcccagttat
catgtccattgaggagaagatggaggcagatgcccgatctatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagcacactttcatggctgtggttcagtcaaccgcgttactatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagctcgatacc
gtgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|C7F841_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Sus scrofa GN=BCL2A1 (length=528 residues).
atgactgacgacgagtttggatatattcacatgctggcccaggactatctgaagtatgtcctgcagataccacaacctgg
atctggtccaagcaaaacatctagagtgttacgagacgtggctttctccgtccaaaacgaagttgaaaagaatttgaaac
catgcttggacaattttgatgttgtgtccatagacactgccagaataatattcaatcaagtgatggaaaaggaatttgaa
gatggcatcattaactggggaaggattgtgaccatatttgcatttgaaggtattctcatgaagaaacttctgcgaaagcg
aattgccccagatgtggacacgtacaaggagatttcttactttgtcgccgagttcatcaccaaaaacacaggacagtgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacccaaatctggctggctgacctttgtggaagtt
acaggaaagatctgtgaaatgttatgtctcctgaagcaatactattga
>gnl|bcl2dbcds|C7F841_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Sus scrofa GN=BCL2A1 (length=528 residues).
atgactgacgacgagtttggatatattcacatgctggcccaggactatctgaagtatgtcctgcagataccacaacctgg
atctggtccaagcaaaacatctagagtgttacgagacgtggctttctccgtccaaaacgaagttgaaaagaatttgaaac
catgcttggacaattttgatgttgtgtccatagacactgccagaataatattcaatcaagtgatggaaaaggaatttgaa
gatggcatcattaactggggaaggattgtgaccatatttgcatttgaaggtattctcatgaagaaacttctgcgaaagcg
aattgccccagatgtggacacgtacaaggagatttcttactttgtcgccgagttcatcaccaaaaacacaggacagtgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacccaaatctggctggctgacctttgtggaagtt
acaggaaagatctgtgaaatgttatgtctcctgaagcaatactattga
>gnl|bcl2dbcds|F1RZB9_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Sus scrofa GN=BCL2L10 (length=555 residues).
atggcggacgcgttcagggagcgcacagcccggcttctgaccgactacctggagtactgcgcccgggagcccggcaccgc
cgcgcggcagccgtcctcgcccgaggccgcagtgctgcgttgcgtggctgcccagatacgggagtacaacgtgcgcacct
tgtctgtctaccgcggcttccgctggaaccgtgtcgaattggtggcctggatggcacagaaactactcgcaagcccacgt
ggccccaactggtaccgcgtggcatcactcttgaccttcgcagggatgctgctggaaagacatcctcgggaggcctgtgg
gcggaagaagaaggagggcaacgttagcagggactgccgactcctggtggctttgctgtgcgctcagctctcagggcagc
atcgcacctggctattggcgaacggcggctgggatggattttgtctcttcttccaaggttcattgcaacaaacttggaca
agacacatggtctgggtttttgtgtcatactgtacagcagtggtcttactctacttgtggagaaaattattgtga
>gnl|bcl2dbcds|K9IWB2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=1056 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggctacgggaaaagaggccacggcccggcaagaggtagggggaggggaag
ccggcatggtgattggcggaagcgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacccgcctcgcgtc
gccgcctgaagagatggaatccccggcctccgacgccatcatgtctcccgaagaggagctggacgggtacgagccggagc
ccctcgggaagcggccggccgtcctgcccttgctggggttagtcgaggaggccagtagtggccccggcacggacggctcg
ctcccctcgacgccgcccccggcagaggaggaggaggacgagttataccggcagtccctggagattatctctcggtacct
tcgggagcaggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccgttagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggc
atatctaataagatag
>gnl|bcl2dbcds|K9IWB2_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=1008 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggctacgggaaaagaggccacggcccggcaagaggtagggggaggggaag
ccggcatggtgattggcggaagcgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacccgcctcgcgtc
gccgcctgaagagatggaatccccggcctccgacgccatcatgtctcccgaagaggagctggacgggtacgagccggagc
ccctcgggaagcggccggccgtcctgcccttgctggggttagtcgaggaggccagtagtggccccggcacggacggctcg
ctcccctcgacgccgcccccggcagaggaggaggaggacgagttataccggcagtccctggagattatctctcggtacct
tcgggagcaggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccgttagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
catgtagaggacctagaaggcggcatatctaataagatagccttttaa
>gnl|bcl2dbcds|K9IWB2_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=1056 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggctacgggaaaagaggccacggcccggcaagaggtagggggaggggaag
ccggcatggtgattggcggaagcgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacccgcctcgcgtc
gccgcctgaagagatggaatccccggcctccgacgccatcatgtctcccgaagaggagctggacgggtacgagccggagc
ccctcgggaagcggccggccgtcctgcccttgctggggttagtcgaggaggccagtagtggccccggcacggacggctcg
ctcccctcgacgccgcccccggcagaggaggaggaggacgagttataccggcagtccctggagattatctctcggtacct
tcgggagcaggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccgttagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggc
atatctaataagatag
>gnl|bcl2dbcds|O77737_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sus scrofa GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tactgatgtggaagagaacagaactgaggccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgaggtaccggagggcattcagtga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagctttgagcaggtattgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacggaaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgatggt
tcctgacgggcatgactctagctggggtggttctgctgggttcgctcttcagtcggaaatga
>gnl|bcl2dbcds|Q95KR3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=459 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtcc
acgttttaagtgacggagtaacaaactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttg
aagagtataaatcaagaaagctgcatcgaaccgttagcagaaagcatcacagatgttctcgtaaggacaaaacgagactg
gctagtcaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgc
tgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|H0YUX3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Taeniopygia guttata GN=BCL-2 (length=729 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctctcagagggg
atacgactgggctgccggcgaggacagggcatccctgcctccagatcactccgcttctgctgctgctgcgattgctgctg
ctgcgattgctgctgctgggacttctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctactgct
agccacacgcccccagccgaggggctgcgccctgcaccccaggccgtccacctcgtcctgcgccaggcgggggatgagtt
ctcccgacgctaccagagagacttttcccaaatgtctggccagctgcacctgacgccctttacagccaggagccgcttcg
tggcggtggtggaggagctcttccgagatggggttaactggggcagaattgtggccttcttcgagtttggcggtgtgatg
tgtgtggagagcgtcaacagggagatgtttcccctcgtggacaacattgccacctggatgactgagtacctgaaccggca
cctgcacaactggatccaggacaacggaggctgggatgcctttgtggagttgtatggcaacaatatgaggcctttgtttg
atttctcctggatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatcttgga
cataagtag
>gnl|bcl2dbcds|H0Z8G3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Taeniopygia guttata GN=BCL2L1 (length=687 residues).
atgtacagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagaaaggatacagctggagtcagct
ggaagaggaggatgagaacaggactgactttgcaggggaggaggacgagatggacggggtcctcaacgggagcccctcct
ggcacgcggccaccagccacatagtgaatggagccaccgtgcaccagaacagcctcgaagtccatgagatccgtcgagca
gctgatgtgaggcaggcgctgagagaggcgggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcacttc
ccagctccacatcactcccagcacagcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgttaaggagatgagggtattggtg
aaacgcatcgtctcttggatgaccacgtacttgaccgaccacttagatccctggatccaggagaatggcggatgggagcg
ctttgtggactctatgaacgatgctgctgccgagatgagaaaaggccaggagttcaacaaatggctcctgacgggggcga
cggtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|H0ZCL9_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Taeniopygia guttata GN=BCL2A1 (length=525 residues).
atggaaactgctgagttctattacgtttattacttagcccaggattatctgcagtatgtgctccaggaatcacacctcgg
accagcccagacccgggttgctcatgtcctgagaaccatggcatcctctctgcaagaccaaacggaggaggctgtcaggc
cgctcctggacaggattgacatcacctctgtagcggctgccaagagaattttcaatggagtcatggatgaaaagtttgct
gatggaaatactaactggggacgaatcatgaccatctttacatttggaggtcttctcaccaagaagcttcaagagcatgg
ggttcagctgactgcagaggagaaggagcagatttcttatttcatcacggagtacatcatcaacaacaaagccgaatgga
ttgatgcgaatggtggctgggaaaatggcttcctaactaagtttgaaagaagatcactactgtccttctccaaaattaca
gccctgttcatagctcttgtgtccttgttcagagagtactactga
>gnl|bcl2dbcds|A0A0F7L1T6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Takifugu obscurus GN=BCL2L1 (length=657 residues).
atgtcgtataacaacagagagctggtggagcacttcttaagatacaagctgtctcagaggaactacccatcttctctgct
gagaccagaggatactgatggaaggacagagggagaaaagaggagccccgctgcttccaatggcctgctggtccgcagca
ggaacaggggtggagcgtctccatccgcaggtgctggcattgaggctgtgaacgcagctcttcgggactcggcagaagag
tttgagaagctctttgctcaagcattcagcgacctctcctcacagctcgacatcactcctgacacggcttaccagagctt
taagaatgtgatggacgaggtgttcaaggacggagacaactggggacgagttgtgggactatttgcctttggcggggtac
tatgtgtggaatgtgtcgagagggatgcgagccaactggtttgccgcattgcagactggatgaccatttacctggatgag
catattaacccgtggatccagagtcaaggaggatgggattgcttcgcgaagatttttggggacgacgccgcggcagaggg
gaggagagctcgcgagaacctgagtagatggatgctgggcggattggcgctgctgatgggagttttggtcggcgctttca
tcgtcaagaaacattga
>gnl|bcl2dbcds|H2RNY4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Takifugu rubripes GN=MCL-1 (length=690 residues).
gacagcccgaagcggcccagcaagctctccgtgatcgcacccaaggtttgcgtggcgaaggccatccaggaggacagcca
ggacaccgaccaccggtcggcgccgtgtacgccggagatgaactcggtgaacgggttggacgtgtccgggcgcccagcgg
aggacgaggcggcgttagacaacgacacgaggcagctcctcagctgcttcatggcggacttttgcggcatcggttcacat
cagtggagggagagcggagcgctgtcgaccatgaagcgagtggtggcgaacctgatggaaaagcaccgatacgtgtacaa
tgggatgaccaaacagttgaccctggacgacagaggagacgatgtgagcttcgtcagctcggtagccaaaagcatattcg
cagacggggtcaccaactgggggcgcatcgccagcctagtggcctttggagccgtggtggcccagcacatgaaggacaat
ggtcggagggactgcgtggagccggtggcgcaggagatctccacgtacctgttgacggaccggcgggactggctgatcaa
aaacaacggctgggaaggatttgtggagtttttccaagtatcggacccagagtcgtcagtcaggaacatgctgatggccg
tcgcgggggttgccgggctcggggccacgctggccctgttgatccggtga
>gnl|bcl2dbcds|H2SNZ9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Takifugu rubripes GN=BCL2L1 (length=657 residues).
atgtctcaaaacagagaactggtcattttctatattaagtacaaactctcccaaagaaattaccctttcaatcacaatgg
actcatattagagcctccaagtaggactgatgggcagtttgtaactactcagttcaatggaacttttaatggtgcaagcc
ctggaacacccccagcaacaagtctggcaacaagtctggatacagtaaaggaagccctccgggacacaggcaatgaattt
gagctgcgatacacttgtgctttcagtgacctgcacaaccagctacacatcaccccagctactgcttaccaaagttttga
gaatgttatggatgaggtatttagggatggagtcaactgggggcggatagtggggctttttgcatttggtggtgctctct
gtgtggagtgtgttgagaaggagatgagtcccctggtgggccggattatagagtggatgacagtctatcttgacaaccac
attcaaccatggatccagagtcaaggaggatgggtccgttttgctgaactctttgggcaggatgcagcagcagaaagcag
gagatctcaggagagattcagaaacggactcctggtggggatgagcctggcagcagggatcgcaatcgggtcgttcatag
tgaggaaactcctgtga
>gnl|bcl2dbcds|H2SNZ9_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Takifugu rubripes GN=BCL2L1 (length=606 residues).
cttgaaacagcaaggcttgaccaagacaagagcagaatcaccccagagcaaagtcaaaaagcgactgatgggcagtttgt
aactactcagttcaatggaacttttaatggtgcaagccctggaacacccccagcaacaagtctggcaacaagtctggata
cagtaaaggaagccctccgggacacaggcaatgaatttgagctgcgatacacttgtgctttcagtgacctgcacaaccag
ctacacatcaccccagctactgcttaccaaagttttgagaatgttatggatgaggtatttagggatggagtcaactgggg
gcggatagtggggctttttgcatttggtggtgctctctgtgtggagtgtgttgagaaggagatgagtcccctggtgggcc
ggattatagagtggatgacagtctatcttgacaaccacattcaaccatggatccagagtcaaggaggatgggtccgtttt
gctgaactctttgggcaggatgcagcagcagaaagcaggagatctcaggagagattcagaaacggactcctggtggggat
gagcctggcagcagggatcgcaatcgggtcgttcatagtgaggaaa
>gnl|bcl2dbcds|H2SNZ9_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Takifugu rubripes GN=BCL2L1 (length=543 residues).
atgtctcaaaacagagaactggtcattttctatattaagtacaaactctcccaaagaaattaccctttcaatcacaatgg
actcatattagagcctccaataaaggaagccctccgggacacaggcaatgaatttgagctgcgatacacttgtgctttca
gtgacctgcacaaccagctacacatcaccccagctactgcttaccaaagttttgagaatgttatggatgaggtatttagg
gatggagtcaactgggggcggatagtggggctttttgcatttggtggtgctctctgtgtggagtgtgttgagaaggagat
gagtcccctggtgggccggattatagagtggatgacagtctatcttgacaaccacattcaaccatggatccagagtcaag
gaggatgggtccgttttgctgaactctttgggcaggatgcagcagcagaaagcaggagatctcaggagagattcagaaac
ggactcctggtggggatgagcctggcagcagggatcgcaatcgggtcgttcatagtgaggaaa
>gnl|bcl2dbcds|H2U5I3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Takifugu rubripes GN=BCL2L1 (length=657 residues).
atgtcgtataacaacagagagctggtggagcacttcttaagatacaagctgtctcagaggaactacccaacttctctgct
gagaccagaggatactgatggaaggacagagggagaaaagaggagccccggtgcttccaatggcctgctggtccgcagca
ggaacaggggtggagcgtctccatccgcaggtgctggcatagaggctgtgaacgcagctcttcgggactcggcagaagag
tttgagaagctctttgctcaagcattcagcgacctctcctcacagctcgacatcactcctgacacagcttaccagagctt
taagaatgtgatggacgaggtgttcaaggacggagtcaactggggacgagttgtgggactatttgcctttggcggggtac
tatgtgtggaatgtgtcgagaaggatgcgagccaactggtttgccgcattgcagactggatgaccatttacctggatgag
catattaacccgtggatccagagtcaaggaggatgggattgcttcgcgaagatttttggggacgacgccgcggcagaggg
gaggagagctcgcgagaacctgagtagatggatgctgggcggattggcgctgctgatgggagttttggtcggcgctttca
tcgtcaagaaacattga
>gnl|bcl2dbcds|H2U5I3_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Takifugu rubripes GN=BCL2L1 (length=600 residues).
atgtcgtataacaacagagagctggtggagcacttcttaagatacaagctgtctcagaggaactacccaacttctctgct
gagaccagaggatactgatggaaggaacaggggtggagcgtctccatccgcaggtgctggcatagaggctgtgaacgcag
ctcttcgggactcggcagaagagtttgagaagctctttgctcaagcattcagcgacctctcctcacagctcgacatcact
cctgacacagcttaccagagctttaagaatgtgatggacgaggtgttcaaggacggagtcaactggggacgagttgtggg
actatttgcctttggcggggtactatgtgtggaatgtgtcgagaaggatgcgagccaactggtttgccgcattgcagact
ggatgaccatttacctggatgagcatattaacccgtggatccagagtcaaggaggatgggattgcttcgcgaagattttt
ggggacgacgccgcggcagaggggaggagagctcgcgagaacctgagtagatggatgctgggcggattggcgctgctgat
gggagttttggtcggcgctttcatcgtcaagaaacattga
>gnl|bcl2dbcds|A0A1U7T4L4_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Tarsius syrichta GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggcctcagaagggactgagtcggagatggagacccccagtgccgtcaatggcaaccca
tcctgggacagcgtatcagagttttgaacaggtagtgaacgaactcttccgggatggggtaaactggggtcgcatcgtgg
cctttttctccttcggcggggcactgtgtgtggagagcgtagacaaggagatgcaggtattggtgagtcggatcgcaact
tggatggccacttacctgaatgaccacctagagccttggatccaggacaacggcggctgggacacttttgtggaactcta
cgggaacaatgcagcagctgagagccggaagggccaggagcgcttcaaccgctggttcctgacgggcatgaccgtagctg
gcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A1U7T4L4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Tarsius syrichta GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagaacaggactgaggcctcagaagggactgagtcggagatggagacccccagtgccgtcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagctgtgaagcaagcgctgagggaggcaggcgatgagtttgaactgcggtaccggcgggcattcagtga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagttttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcatcgtggcctttttctccttcggcggggcactgtgtgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggacaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagctgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgaccgtagctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A1U7UJF2_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Tarsius syrichta GN=BCL2L2 (length=537 residues).
atggaggaggaagctgaaaagctaaaagagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaa
tgctggcccagtgatcatgtccattgaggaaaagatggaggctgatgctcgttccatctatgttggcaatgtggactatg
gtgcaacagcagaagagctagaagctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaattt
agtggccatcccaaaggttttgcttatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgagtc
cctatttagaggaagacaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcc
cacgagcccgctaccgtgcccggaccaccaattacaacagttcccgctctcgattctacagtggttttaacagcaggcct
cggggtcgcgtctacaggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A1U7UJF2_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Tarsius syrichta GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctggtggcagactttgtaggctataagctgaggcagaagggtta
tgtctgtggagccggccctggggagggcccagcagccgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcacgttctctgatctggcggctcagctgcatgtgaccccaggctcagcccagcaacgcttcacc
caggtctctgatgaacttttccaagggggccccaactggggccgccttgtggccttctttgtctttggggctgcactctg
tgctgaaagtgtcaacaaggagatggagccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggagccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A1U7UJF2_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Tarsius syrichta GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcagccccagacacacgggctctggtggcagactttgtaggctataagctgaggcagaagggtta
tgtctgtggagccggccctggggagggcccagcagccgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcacgttctctgatctggcggctcagctgcatgtgaccccaggctcagcccagcaacgcttcacc
caggtctctgatgaacttttccaagggggccccaactggggccgccttgtggccttctttgtctttggggctgcactctg
tgctgaaagtgtcaacaaggagatggagccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggccgactggatccacagcagtgggggctgggagctggaagcgatcaaagcccgagtcagggagatggaggaggaagct
gaaaagctaaaagagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaggaaaagatggaggctgatgctcgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctagaagctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
ggttttgcttatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgagtccctatttagaggaag
acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccacgagcccgctacc
gtgcccggaccaccaattacaacagttcccgctctcgattctacagtggttttaacagcaggcctcggggtcgcgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A1U7UZD8_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Tarsius syrichta GN=BCL2L10 (length=588 residues).
atggccgacccgctggaggagcgtaccgcgcggctgctggctgactacctggagtactgcgcccggccgcccggcagccc
cgagccgcggccgtcctcgcccgaggccgccgtgctgcgctccacggccgccaggctgcggcagcggcacgcctccttct
tctcggccttcgttgactaccccgggagccgcgtggacctgacggcgcggatggccgatgccgtgctctctggcagccgc
gacctcagctggggccgcgtggtgacgctcgtgaccttcgcggggacgcttctggagcgaggaccgctgctgcccgccgg
ggggcagcagcggggcttcaggccccggcggaagaaggaggagggcgacgttgcgcgggactgccagcgcctggtggcct
tgctgagcgcgcggctcgcggggcggcaccgcgcctggctgcaggctcaaggcggctgggatggcttttgtgtcttcttc
agtacacccttaccactaactttttggagaagactgccggttcaggcgtttgtgtcatgccttttagcaatggccttcat
ctattttttctggacacgattattatga
>gnl|bcl2dbcds|H3CH49_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Tetraodon nigroviridis GN=BCL2L1 (length=696 residues).
cgaagtcaccccggagcaaagtcaaaaggcgcatctacgcagaggatgtctctaaacagagaactggtcattttctacat
taaatacaaactttcccaaagaaactaccctttgagtcacattgtagagccttcaagtaggactgaagggcagtttggaa
ccacccagtccaatggaacttttaatggggcaagtcctggaacccccccagcaccctcccagcaccagcagtcattgaca
agtctggacgcagtcaaggaagccctccgggacaccggcaatgaatttgagctgcggtacacctgcgcgttcagtgacct
gcacaaccagctccacatcacgccagccacggcttaccaaagttttgagaacgttatggatgaggtgtttcgggatggag
tcaactgggggcggatagtgggcctttttgccttcggtggtgccctgtgtgtggagtgtgtggagaaggagatgaatcct
ctggttggccggatcatagagtggatgacggtctatctggacaaccacatccagccctggatccagagtcaaggaggatg
ggaacgttttgctgaactcttcgggcaggacgcggctgcagaaagccgcaggtcccaggagcgattccgaaacgggctgt
ttctgggcatgagtctggcggcagggatcgccctcggctccttcatcgtcatgagg
>gnl|bcl2dbcds|Q4SW32_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Tetraodon nigroviridis GN=MCL-1 (length=816 residues).
atgagcgttatcgcgaaccgcaccgcgatagacaccatgaatgttatgtttcaaaatggagtcggggacgcggatctttc
ttcctcgcagatcccgatgggctctcccagggacgctttcaacgggaacgtcggcgacagcccgaagcggcccagcaagc
tgacggtggtcaaacccaaggtctgcctgtcgaagaccattcaggaggacagcgaggacggctcgctgccgtgtacgccg
gagtcgcactcgggcgacgtgctggacgtgtccgggcgtccggcgggggacgaggcggctctcgacagcgacacgaggca
gctggtgagccgtttaatggcggacgttaccggcatcagcagagcccagtggagggagagcagagcgctggcgacgacga
agcgagtggtgggagacctgatggagaagcaccgatacacgtacagaggtatgatcaacaaattgttcatggaggaccga
gtaggcgacgtgagctttgtcggcgccgtggctaagagcacgttcgaggacgggaacaccaactggggtcgcgtggccag
cctgctggccttcgcagccgtggtggcccagtacttgaacgaccacggtcagagggactgcgtggagcaggtggcccagg
aaatctccacctacctgttgacggaccagcgcgactggctgatcaaaaacaacgcctgggacggatttgtggagtttttc
caagtgccggacccggagtcgacggtccggaccgtgctgatggccgtggcaggagtggctgggatcggcgccaagctggc
gctgctgatcaggtga
>gnl|bcl2dbcds|B6V6J0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Xenopus laevis GN=MCL-1 (length=828 residues).
atgatgcaccagtcagtaattgccaagcagcgcccctcgactagtttcctcattccctgccagttttactgctcgggcgg
cggctcctcagagaagacattgagcgcgcgtggggcttctccgtgggaccccgatatggacacgcacaggccgcagctga
atggcttgggctttaacaacggggggtcgctgccttgttcccaggaggatgaattagatgaggatatggataacggatcc
cagggttccacgtctcccccggacagccccgtgtgccctaaggatggattatatatggacacccagcagctcattctcgc
tttctaccgcgtgtacagcggcgaggagagcggcgaattagaggcttcctgtctcctccaacatggcgtccaccacaaag
ccctggaaaccctgctgagggtcgggggagagattatagagaagcaccacatggccttcacgggcatgctacaaaggttg
tctatacatagcagagaagacttgcagaaactttctgaggttcccgctttggtctttaatgacggagttacaaattgggg
ccgcattgttacggtcataagctttggcgcgtttgttgcaaagcatctaaagagcttaaaccttgaagactgcatcggag
ttttggcagagcacttcacgcagttcctaatgatgagcaaaaaagactggataatacaggaaaagggatgggatggcttt
gtggacttttttcacatagaagattatgaaagtggactgaaaactgttttgatggctttctcaagtgttgctgttcttgg
ggccggtttggcgtacatgatccgatga
>gnl|bcl2dbcds|B9ZYL7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Xenopus laevis GN=BCL-2 (length=885 residues).
atggctcatcctagaagaggaggctatgatcaccgggacatagtggtaaaatatatccattataaactatctcagaaggg
gtatgcatgggaagagggaaggcagcaggtctctgctgagcaccctcaagcttctgctgctattagtaattattctgatg
atggagaaatgcctgctgcttccgcagattcacgtggaccacctcagtcttcactcgcatctgctgcttcctcagatgag
gaaaccccaagtaatactccaataacctttgtgggcaatgcacctgctgttcccaggaggtctgcatctgctgtttcacc
cttagctgaattgaatgtcgaaccaagagatcttaatgttaatccagatgccagtcgtgctgcagatggtgataataatg
atgctgatggtggtgatgaagctgttatgcagccagtcccttcggcagtgctacagaccttgagtcgagctggagatgag
ttctctcgcctatatcagcaagatttcagacagatctcagggctcctccatttaaccccatccacagttagggtgcgctt
tgcaacagtggtggaggagctctttcatgatggggtaaactggggaaggattgttgcttttttcgagtttggtggggtca
tgtgcgtggagattgttaaccgcgaaatgtctcctctggtggactccattgtgggttggatgacagagtacctaaaccgt
cacttacaaaattggatccaggaacaggatgcatttgtggagctgtacaacagcaatatccagccaccgtttgaccagag
ctggttatccatcaagacaatattaagccttgctgtggttggagcctgcatcacaatagggggcatatccttggccacca
aataa
>gnl|bcl2dbcds|Q2TAP5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Xenopus laevis GN=BCL2L1 (length=615 residues).
atggagggcagcagtagagatctggtggagaagtttgttagtaagaaactttcccagaatgaagcctgcaggaagttctc
caataatccccaacccaatgccatatctaatggaacttctacttcagagcgccccggggaaggggccacgcagggcattg
tggaggaggaagtccttcaagcccttttggaagcaacggaggagtttgagttgagatatcagcgtgccttcagtgacctg
acctcacagctgcacatcacccaggacacggcccagcagagcttccagcaagttatgggagagttgttcagggatgggac
aaactgggggagaattgtggctttcttctcatttgggcgggccctatgtgtggagagtgcaaacaaggagatgactgatc
tgctacccagaattgtccagtggatggtgaattatctagagcacacactgcagccctggatgcaggagaatggaggctgg
gaagcttttgtcggcctgtatggaaagaatgccgcagcccagagcagagaaagccaggaacgatttggcaggttgctgac
tatagtgattctgactggtgttttcgcattggtctgctacatgaggcgccgatag
>gnl|bcl2dbcds|Q91828_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Xenopus laevis GN=BCL2L1 (length=615 residues).
atggagggcagcagtagagatctggtggagaagtttgttagtaagaaactttcccagaatgaagcctgcaggaagttctc
caataatcccaacccaatgccatatctaatggaaccttctacttcagagcgccccggggaaggggccacgcagggcattg
tggaggaggaagtccttcaagcccttttggaagcaacggaggagtttgagttgagatatcagcgtgccttcagtgacctg
acctcacagctgcacatcacccaggacacggcccagcagagcttccagcaagttatgggagagttgttcagggatgggac
aaactgggggagaattgtggctttcttctcatttgggcgggccctatgtgtggagagtgcaaacaaggagatgactgatc
tgctacccagaattgtccagtggatggtgaattatctagagcacacactgcagccctggatgcaggagaatggaggctgg
gaagcttttgtcggcctgtatggaaagaatgccgcagcccagagcagagaaagccaggaacgatttggcaggttgctgac
tatagtgatgctgactggtgttttcgcattggtctgctacatgaggcgccgatag
>gnl|bcl2dbcds|F6TEC3_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Xenopus tropicalis GN=BCL2L2 (length=678 residues).
cgaaaaaaggggaataacggcgtaaaggaccgagattgggaagaacagcatgcgacgggaaatatcatcttccgggggag
ccccgataagtacctgacggagcaaggctggatggcgcaatctgaactaggatcccgggctttggtagaggattttgtgc
gatacaagttatgccagcgtagtctagttccggagcctgcaggagcagcatcctgttctttgcattcagccatgcgtgct
gcaggggatgaatttgaagagagattcagacaagcattcagtgagatctccacacagatccatgtgacccctggcacagc
atatgcacgctttgcagaagtagcaggtagcctgttccaaggtggggtgaattggggtcgtatagttgcattttttgttt
ttggtgccgcactgtgtgctgagagtgtcaacaaggagatgtcccctcttctgccacggattcaggactggatggtgaca
tatctggagacaaacctgagagactggattcagagcaatggaggctggaatggatttctaactctatatggggatggtgc
catagaagaggccaggaggcagcgtgaggggaattgggcatcactgaagactgtcttaactggagcagtagctctgggtg
ctttaatgacagtaggagccttgtttgccagcaagtga
>gnl|bcl2dbcds|F7BXJ7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Xenopus tropicalis GN=BCL-2 (length=573 residues).
atggctcatcctaggagaggaggctatgatcaccgggacatagtggtaaaatatatccattataaactgtctcaaaaggg
gtatgaatgggaagaggggcggcagcaggtctctgctgagcaccctcaagcttctgctgctattagtaattattctgatg
atggagaaatgcctgctgcttccgcagattcacgtggaccacctcaatcttcactcgcatctgctgctgcttcctcagca
gctatgcagccggtccctccagcagtgctacagaccttaagtcgagctggagatgagttctctcgcctctatcagcaaga
ttttagacagatctcagggctcctccatttaaccccatccacagttagggtgcgctttgcaacagtagtggaggagctct
ttcatgatggggtcaactggggaaggattgttgcttttttcgagtttggtggggtcatgtgcgtggaaagtgttaatcga
gaaatgtctcctctggtggattccattgtgggttggatgacagagtacctaaacagtcacttgcaaaattggatccagga
acagggaggatgg
>gnl|bcl2dbcds|F7ETY1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Xenopus tropicalis GN=MCL-1 (length=852 residues).
atgatgcgccagtcggtcattgccaagcagcgtacctctgcgggcttcctcatcccctgccagttctactgctcgggtgg
cggcggcgggaacgcctcagagaaggcagtgaatgaccgaggggcttctccgtgggacgccgatatggaggcgcataggg
ataagctggacaggccgcagctgaatggcttcgggtttaacagtggggggagccttactgcctcccaggagggagaattg
gatgaggatattgatggcggctcccagggttctagctcccccccggacagccctgtgtgcccgaaggatggattatatat
ggacacccagcagctcatcctggctttcttccggggatactgcggggaggaaaccagcggcttaaaggcctccttcctcc
tccatcatggcgcccaccccaaggccctggagaccctgcagcgggtcgggggagacattatagagaagcaccatatggcc
tttactggcatgctgcaaaggttgtctatacatagtagagaggacttgcagaaactttccgaagttcccgctttggtctt
taatgatggagttacaaactggggccggattgttaccgtcataagctttggtgcgtttgttgcaaagcatctaaagagca
tagaccttgaagactgtatcatggctttggcggagcacttcacactattcctaatgacaagcaaaaaagactggataatc
caggaaaagggatgggagggctttgtggacttttttcacatagaagactatgaaagtggactcagaactgttttgatggc
tttctcaagtgttgcggttcttggggctggcttggcgttcatgatccggtga
>gnl|bcl2dbcds|Q5XGJ4_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Xenopus tropicalis GN=BCL2L2 (length=567 residues).
atggcgcaatctgaactaggatcccgggctttggtagaggattttgtgcgatacaagttatgccagcgtagtctagttcc
ggagcctgcaggagcagcatcctgttctttgcattcagccatgcgtgctgcaggggatgaatttgaagagagattcagac
aagcattcagtgagatctccacacagatccatgtgacccctggcacagcatatgcacgctttgcagaagtagcaggtagc
ctgttccaaggtggggtgaattggggtcgtatagttgcattttttgtttttggtgccgcactgtgtgctgagagtgtcaa
caaggagatgtcccctcttctgccacggattcaggactggatggtgacatatctggagacaaacctgagagactggattc
agagcaatggaggctggaatggatttctaactctatatggggatggtgccatagaagaggccaggaggcagcgtgagggg
aattgggcatcactgaagactgtcttaactggagcagtagctctgggtgctttaatgacagtaggagccttgtttgccag
caagtga
>gnl|bcl2dbcds|Q6GLI5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Xenopus tropicalis GN=BCL2L1 (length=606 residues).
atggagggcagcagtagagatctggtggagaagtttgtttgcaagaaactgtcccagaaaggagcctgcggggagttctc
cagcaactcccagcccaagggcgtgtctaatggaagttcggagggccccggggccacacagggcattgtgggggaggaag
tccttcaggcgctgctggacgcgtcggaggagtttgagttgagataccagcgtgccttcagcgacctgaccgcccagctg
cacctcacccaggacactgcccagcaaagcttccagcaggtggtgggggagttgttcagggacggcaccaactggggcag
aatcgtggccttcttctcctttgggcgggccctgtgcgtggagagtgccaacaaggagatgactgagctgctccccagga
tcgtgcaatggatggtgcagtacctggagcatacgctgcagccctggatgctggagaacggaggctgggaagcttttgtc
ggtctgtacggaaagggagctgccgcccagagcagggaagggccggagcggtttggccggtggctaatggccatagtgac
tgtgactgctgcaaccttattggtctcctacctgaggcgtcgatag
>gnl|bcl2dbcds|M4A3H9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Xiphophorus maculatus GN=MCL-1 (length=828 residues).
atgacagctaattcgacaaacgcgttaaactatctcattttttctcaaaatggagtcgggaatggacaaacacactacga
ccagggactcggtgtgcctgaggtcgcaatgggctccactgtagaatctcttcattcgcctaaggatcccttcatgaaac
gcccgacgaatctcggagtgaatggatatgttgcgaaaagccttccgacgagcagcgacgacagcgacgaaggctctctg
ccatgcaccccggcgcagcacccagacagtgaaaaagacgcgacggccgtaggtgcgagcaaccaagtgctggataacga
cacaacggagcttattagcagttttctgagagactttacgggactttcaaagtgtcggtggggtcaaaataaagctctat
ctacgatgaaaagggtggtggaggaccttttgtcgaagcacaagtatgcatacaatggtatggtcaataggcttgctctg
gataacgagccggacgacatggagtttgttacggaaatagcagagagtctcttttcagacgggatcaccaactggggtcg
gatcgccagcctggtgacgttcggggctgcggtgtgtcagcgcctgaaggagaggggcagagagcactgcgtggagctgg
tgagccggaaaatatccacgtatctcctggcaaaccagcgggactggctagcaaaaaacaactcatgggagggctttgtg
gagttctttagagtatcggacccggagtctacagtgaggaacacgctgatggctgttgtgggggtcgctggtattggggc
caccttagcctttcttatcagcttctga
>gnl|bcl2dbcds|M4A558_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Xiphophorus maculatus GN=BCL2L1 (length=660 residues).
atggcctacagcaacagagaactggtggagttctacataagctacaaattgtctcagagaaactattcaagctctctgct
gaggtccgaggttgccgggggcaggaccaattgggaaggggacagccgggtccctagcaatggccggctggtcaacagcc
gggccgggcccccggggaagcccaggggcccaatggccggtgttgaggtcgtcaaatcagttctgaaggacgcggcggag
gagtttgagcgcctctacacccaaagctttaaacacctctccttgcagctggacatcacccccgacacggcctaccacag
cttcaagaccgtgctggacgagttgttcaagggcggggtcaactgggggcgggtggtggccatgtttaccttcgggggga
ttctgtgtgtggactgcgtccagaagaatatgagtgagctggtctcccgcattgccgaatggatgaccacttacctggat
gagcagctcagtccctggatccagagccagggaggatgggaccgctttgctaacctgtacggccaggacgccgctgcaga
gggccggaggtttcgggagaccttgaacaaatggctgctagttggtgtggctctgctgaccggagctctgctcgtcgtgt
tcgtcgctaagaaacgatga
>gnl|bcl2dbcds|M4AQF9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Xiphophorus maculatus GN=BCL2L1 (length=618 residues).
caaaaaatgtcacgaaacagagaactggtgcttttctacattaagtttaaactgtctcagaggaactatccgatccaaca
catattgcccaacgagcccccggacggcaccgctgccggggacgtggggatggacgacgagcagacgttagagacacacg
ctaatgggacttttaacgggacgagtccaggatcccctaggcggcaccaggcggcgtcggcgtcaacgatggacgcggtg
aaagtggccctgcgcgacacggcccgtgagtttgagctgcgctactcccgcgccttcaacgaccttcacagcacgctgca
catcacaccggccaccgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactggggccgca
tcgtggggctcttcgcgtttggtggcgcgctgtgcgtggagtgcgtggagaaggagatgagccacctggtagccaggatt
gtagagtggatgaccgtctacctggatgagcagattgaaccttgggtagaaagccaaggaggatggctgaagactgctgt
tatatttaaccaaggaatgagaatagaaaccagaaattggcatgagccagacaagcgt
>gnl|bcl2dbcds|M4AUW7_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Xiphophorus maculatus GN=BCL2L10 (length=651 residues).
atgcgccgaggttctccttccgccgtctggatgtgcagagagccgtcacatatcgctgggaggaaaatgtcctgtgggct
gtggaaagagaccgtggttgttgcagaggattacatccgcctgcgctgctcaagcccacacccagcccctccacctccca
gcgagccggccgccgccatgaggcgcctggcccaggacgtggaggccaagcaccaggctcgctttcactccctggcccag
ggcttcctgaagcactgcgggtcggacctctgctccaacctcagaaaggtgatggatgagatggtgggggacggacactt
taactgggggagggtggtgtccctcttcgccttcgccggcgtgctggccagacagctgcgggaacagacgggcaagaacc
cggtgccggactccgggaagcagcaggaactgcaacaagagcccgtaagctgccgggcgctggcggagaccattgctgat
tacctggagaagcacaaaaaggactggctacaggaaaataatggatgggaagggttttgtagctatgcccgcaacgccag
agaagcaagtcaggactcctccatgaagacggcgctggttgctgtcgccggggtcggcatcgctggactcaccttcctcc
tggtgcgctag
© 1998-2018