Dataset for CDS BCL2L10 of organism all

[Download (right click)] [Alignment] [Repertoires]

40 sequence(s)

>gnl|bcl2dbcds|G1LKR4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL2L10 (length=582 residues).
atggcggacgcgttgaggggcacggcgcggctgctgaccgactacctggagtactgcgcccgggagcccggcacccctgc
gcgggcgccgtccacgcccgaggccgcggtgctgcgttcggtggccgcccaggtacagcagcgtcacgagcgcttcttgt
ccgattaccgcggctacgccggcggcaaccgcgtggagctggtggctcaggtggagcgggagatactcgcccacccccag
cccctaagctggggccgtgtggtggcgctcttgaccttcgcgggcacactgctggagagatcgccgtcggggacctactc
gaacctggggccggaccaggaactggagctgggggagtgggaggccggcgtccgccaggactgccggcacctggtggact
tcctctgcaatcggctcacgggacagcatcgcgcctggctggaggcgcacgacggctgggatggcttttgtctcttcttc
acacccatgctgccgtcgtcttggaaaagactgctggcccaggctcttctgtcctgcttcacagcggtgatcttaatcta
cttctggaaaaggttattgtga
>gnl|bcl2dbcds|A0A2K5F974_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L10 (length=642 residues).
atggctgacccgctgcggcagcgcaccgagcggctggtggcggactacctggagtactgctcccaggagcctggcacccc
cgagtcgccgccgtccacggccgaggccgctgtgctgcgcgccatggccgccggtgtacggaaactctaccggtccttct
tctccgcctacctcggctacccggggaaccgcgtcgagctggtggcgaggatggcggaggccctgctctccgacagtccc
ggccccacctggggcaacgtggtgatgctcctggccttcgcggggacgctgctagagagggggccgctggtgaccgcccg
gtggaagaagtggggcttccagtcgcggctgaaggagccggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcggctcgtggggcagcaccgtgcctggctggaggctcagggcggctgggtgagcatgcggagggggaca
cgggcctcccgagtagctgggaatataggatggcttttgttacttcttcaggacctcctcctcgctggcattatggagaa
aactgctggtccaggttttcctgtcatggttgttaacagcagcattcatctacttctggacacgataattaggagttttt
aa
>gnl|bcl2dbcds|E1B9B3_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Bos taurus GN=BCL2L10 (length=633 residues).
ggagccatggtggacccgtttagggagcgcaccgcccggctgctgatggactacctggagttctgcgcccgggagccggg
cactccagctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggccgcacgtatccaggaagcaaatcgaa
acgtcttgcccctataccgccgctgccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctactcgacgaa
gaccctggccccagctggggccgcgtggcctcactcgtaaccttcgcggggtcgctgctggagaggccaccgcagacgac
ccgacggcaggagaagagagacgacgacggcgttagcagggactgtcggctcctggtggcccttctgtgtgctcagttct
gcgaaaggcaccgcgcctggctgatgactaacggcggctgggatggattttgtctcttcttcagccactcattccagcca
tcttgggaaagacagctggtctggtttttcctctcatactggacagcaataatcataatctacttctggataaaattatc
agccaacatggacccagccaagcttgtcagcagccaggggaataacatctgtgtggataaaaagccagcctag
>gnl|bcl2dbcds|F1MV39_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Bos taurus GN=BCL2L10 (length=555 residues).
ggagccatggtggacccgtttagggagcgcaccgcccggctgctgatggactacctggagttctgcgcccgggagccggg
cactccagctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggccgcacgtatccaggaagcaaatcgaa
atgtcttgcccctataccgccgctgccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctactcgacgaa
gaccctggccccagctggggccgcgtggcctcactcgtgaccttcgcggggtcgctgctggagaggccgccgcagactac
ccgacggcagaagagagacgacgacggcgttagcagggactgtcggctcctggtggcccttctgtgtgctcagttctgcg
aaaggcaccgcgcctggctgatggctaacggcggctgggatggattttgtctctttttcagccagtcattccagccatct
tgggaaagacagctggtctggtttttcctcgcatactggacagcaataatcataatctacttctggataaaatta
>gnl|bcl2dbcds|F7CT87_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L10 (length=681 residues).
atggctgacccgctgcggcagcgcaccgagcagctggtgacggactacctggagtactgctcccgggagcctggcacccc
cgagtcgccgccgtccaccgccgaggccgctgtgctgcgcgccgtggccgccagtgtgcggaaactctaccggtctttct
tctccgcctacctcggctaccccgggaaccgcgtcgagctggtggcgaggatggcggaggccctgctctccgacagtccc
ggccccacctggggcaacgtggtgatgctcctggccttcgcggggacgctgctagagagggggccgctggtgaccgcccg
gtggaagaagtggggcttccagtctcggctgaaggagccggaaggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagttcgcggctcgtggggcagcaccgtgcctggctggaggctcagggcggctgggtgagcaaggagggggacacg
gggcgggataggcacctgggaaccgcccgcccacgatggcttttgttacttcttcaggacctcctccttgctggcattat
ggagaaaagtgctggtccaggttttcctgtcatggttgttaacagcagtattcatctacttctggacacgataatgagga
gttttaaaagttttagcccacttctacctgcccaactgtga
>gnl|bcl2dbcds|A0A2K5MMZ4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Cercocebus atys GN=BCL2L10 (length=585 residues).
atggctgacccgttgcgggagcgcaccgagcggctcctggccgactatctggggtgctgcgcccgggaacccggcacccc
tgagccgaggccgtccacgcccgaggccgccgtgctgcgctcagcagccgccaggttacggcagctccaccggtccttct
tctccgcctaccgcggctaccgcgggaaccgcgtcgagctggtggcgctgatggcggaggccgtgctctccgacagcccc
ggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgctggtgacagcctg
gtggaagaagcggggcttccagccgcggctgaaggagcaggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcagggcggctgggatggcttttgtcacttcttc
aggagcccctttccgctggctttttggagaacactgctgatccaggctttcctggcatgcttgttagcaacagccttcgg
ttatctctggacacgattattatga
>gnl|bcl2dbcds|A0A0D9RG38_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Chlorocebus sabaeus GN=BCL2L10 (length=582 residues).
atggctgacccgttgcgggagcgcaccgagcggctcctggccgactatctggggtgctgcgcccgggaacccggcacccc
tgagcccaggccgtccacgcccgaggccgccgtgctgcgctccgcggccgccaggttacggcagctccaccggtccttct
tctccgcctacctcggctaccccgggaaccgcgtcgagctggtggcgctgatggcggacgccgtgctctccgacagcccc
ggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgctgatgacagcctg
gtggaagaagcagagcttccagccgcggctggagcaggagggcgacgtcgcccgggactgccagcgcctggtggccttgc
tgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcaaggcggctgggatggcttttgtcacttcttcagg
agcccctttccgctggctttttggagaaaactgctgatccaggctttcctggcatgcttgttagcaacagccttcggtta
tctctggacaagattattatga
>gnl|bcl2dbcds|A0A2K5K3B0_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L10 (length=615 residues).
atggctgaccagttgcgggagcgcaccaacgtggctgacccgttgcgcgagcgcaccgagcggctgctggccgactatct
ggggtgctgcgcccgggaacccggcacccccgagccgaggccgtccacgcccgaggccgccgtgctgcgctccgcggcgg
cccgattacggcagctccatcggtccttcttctccgcctacctcggctaccccgggaaccgcgtcgagctggtggcgctg
atggcggaggccgtgctctccgacagccccggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgct
gctggagagagagccgctggtgacagcctggtggaagaagcggagcttccagccgcggctgaaggagcaggagggcgacg
tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcag
ggcggttgggatggcttctgtcacttcttcaggaccccctttccgctggctttttggagaaaactgctgatccaggcttt
cctggcatgcttgttaacaacagccttcggttatctctggacacgattattatga
>gnl|bcl2dbcds|F6ZPD4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Equus caballus GN=BCL2L10 (length=483 residues).
ccggccacgcccgaggtggccgtgctgcgctgcgtggccgcccagatacagccccgcaaccagcgtgttctttcccgcta
ccgcggcttccgcggggaccacgtcgggctggcggcacggatggcgcaggcgatcttcggagaccgccacgtccccagct
ggggccgcgtggcggcgctcgtgaccctggcggggacgctgctggagagagccccgcggggaacctaccgaaagccgaag
cggggctacaagctggagctgagggagtggaaggccggcgtggaccgggacgctgcgcgcctggtggacttcctgtgcgc
atggctcaaggggcggcaccgcgcctggctggaggctcactatggctgggtgggcttttgtgacttctcactcacactgc
cagcttctcagaggatactgctggtccggtttcttctgtcatgcttttcagcatcagtcttaatctacctctggacaaaa
tta
>gnl|bcl2dbcds|D2IT42_BCL2L10-02 BCL2-like 10 gene OS=[Eukaryota] Gadus morhua GN=BCL2L10 (length=588 residues).
atgtcgtgtaggctgtggaaagagaccctggccctgtcagaggactacctgttgtcctgcactgcaagcacaggcacagc
cccgccgcctcccagcgagtcagccgcggccatgaggggactggcccaggacatggagcggcagcactacgctcgcttcc
aggctctggcccagagcttcctggcccagtgcgaggccgacgcatgcgccggcctccgcaaggtgatggaggagctggtg
ggagacggacagttgaactgggggagggtagtttccctcttcacctttaccggggtgctggccagacaactgcaggagaa
gaagggggtacaactggggcaggaccccgggacgggcagggcactgggacaggttcccggcgggagctgcagggggctgg
cggagacgatagcggactacctaggggaggagaagagggactggctgctggagaacgggggctgggaagggttttgtaag
ttctccaggatcgcccgagaggtgaaccaagagtcttcgatgaagacggcgctgttcgcggccgccggggtgggcatcgc
aggcctgacgttccttttggtgcgctag
>gnl|bcl2dbcds|G3QLU6_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2L10 (length=615 residues).
atggttgaccagtggcgggagcgcaccaccatggccgacccgctgcgggagcgcaccgagcggttgctggccgactacct
ggggtactgcgcccgggaacccggcacccccgagccgacgccgtccacgcccgaggccgccgtgctgcgctccgcggccg
ccaggttacggcagattcaccggtccttcttctccgcctacctcggctaccccgggaaccgcttcgagctggtggcgctg
atggcggattccgtgctctccgacagccccggccccacctggggcagagtggtgacgctcgtgaccttcgcagggacgct
gctggagagagggccgctggtgaccgcccggtggaagaagtggggcttccagccgcggctaaaggagcaggagggcgacg
tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcatggggcagcaccgcgcctggctgcaggctcag
ggcggctgggatggcttttgtcacttcttcaggaccccctttccgctggctttttggagaaaacagctggtccaggcttt
tctgtcatgcttgttagcaacagccttcatttatctctggacacgattattatga
>gnl|bcl2dbcds|Q9HD36_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Homo sapiens GN=BCL2L10 (length=615 residues).
atggttgaccagttgcgggagcgcaccaccatggccgacccgctgcgggagcgcaccgagctgttgctggccgactacct
ggggtactgcgcccgggaacccggcacccccgagccggcgccatccacgcccgaggccgccgtgctgcgctccgcggccg
ccaggttacggcagattcaccggtcctttttctccgcctacctcggctaccccgggaaccgcttcgagctggtggcgctg
atggcggattccgtgctctccgacagccccggccccacctggggcagagtggtgacgctcgtgaccttcgcagggacgct
gctggagagagggccgctggtgaccgcccggtggaagaagtggggcttccagccgcggctaaaggagcaggagggcgacg
tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcatggggcagcaccgcgcctggctgcaggctcag
ggcggctgggatggcttttgtcacttcttcaggaccccctttccactggctttttggagaaaacagctggtccaggcttt
tctgtcatgcttgttaacaacagccttcatttatctctggacacgattattatga
>gnl|bcl2dbcds|Q9HD36_BCL2L10-02 BCL2-like 10 gene OS=[Eukaryota] Homo sapiens GN=BCL2L10 (length=726 residues).
atggttgaccagttgcgggagcgcaccaccatggccgacccgctgcgggagcgcaccgagctgttgctggccgactacct
ggggtactgcgcccgggaacccggcacccccgagccggcgccatccacgcccgaggccgccgtgctgcgctccgcggccg
ccaggttacggcagattcaccggtcctttttctccgcctacctcggctaccccgggaaccgcttcgagctggtggcgctg
atggcggattccgtgctctccgacagccccggccccacctggggcagagtggtgacgctcgtgaccttcgcagggacgct
gctggagagagggccgctggtgaccgcccggtggaagaagtggggcttccagccgcggctaaaggagcaggagggcgacg
tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcatggggcagcaccgcgcctggctgcaggctcag
ggcggctgggtgagcacgcggcggacaccgggacacggggcgggacgggcagccgggaagcgcccacgaggctggcacgg
atggcttttgtcacttcttcaggaccccctttccactggctttttggagaaaacagctggtccaggcttttctgtcatgc
ttgttaacaacagccttcatttatctctggacacgattattatgagttttaaaacttttaacccgcttctacctgcccaa
ctgtga
>gnl|bcl2dbcds|A0A2K5TKG9_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L10 (length=585 residues).
atggctgacccgttgcgggagcgcaccgagcggctcctggccgactatctggggtgctgcgcccgggaacccggcacccc
tgagccaaggccgtccacgcccgaggccgccgtgctgcgctccgcggccgccaggttacggcagctccaccggtccttct
tctccgcctaccgcggctaccccgggaaccgcgtcgagctggtggcgctgatggcggaggccgtgctctccgacagcccc
ggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgctggtgacagcctg
gtggaagaagcggggcttccagccgcggctgaaggagcaggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcagggcggctgggatggcttttgtcacttcttc
aggagcccctttccgctggctttttggagaaaactgctgatccaggctttcctggcatgcttgttagcaacagccttcgg
ttatctctggacacgattattatga
>gnl|bcl2dbcds|F7H6U5_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L10 (length=585 residues).
atggctgacccgttgcgggagcgcaccgagcggctcctggccgactatctggggtgctgcgcccgggaacccggcacccc
tgagccaaggccgtccacgcccgaggccgccgtgctgcgctccgcggccgccaggttacggcagctccaccggtccttct
tctccgcctaccgcggctaccccgggaaccgcgtcgagctggtggcgctgatggcggaggccgtgctctccgacagcccc
ggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgctggtgacagcctg
gtggaagaagcggggcttccagccgcggctgaaggagcaggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcagggcggctgggatggcttttgtcacttcttc
aggagcccctttccgctggctttttggagaaaactgctgatccaggctttcctggcatgcttgttagcaacagccttcgg
ttatctctggacacgattattatga
>gnl|bcl2dbcds|A0A2K6B2D9_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Macaca nemestrina GN=BCL2L10 (length=585 residues).
atggctgacccgttgcgggagcgcaccgagcggctcctggccgactatctggggtgctgcgcccgggaacccggcacccc
tgagccaagaccgtccacgcccgaggccgccgtgctgcgctccgcggccgccaggttacggcagctccaccggtccttct
tctccgcctaccgcggctaccccgggaaccgcgtcgagctggtggcgctgatggcggaggccgtgctctccgacagcccc
ggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgctggtgacagcctg
gtggaagaagcggggcttccagccgcggctgaaggagcaggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcagggcggctgggatggcttttgtcacttcttc
aggagcccctttccgctggctttttggagaaaactgctgatccaggctttcctggcatgcttgttagcaacagccttcgg
ttatctctggacacgattattatga
>gnl|bcl2dbcds|A0A1U7QVA0_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Mesocricetus auratus GN=BCL2L10 (length=549 residues).
atggccgacccgctgcgggtccgcactagactgctgctaactgactacttgacgttctgtgcacgggagccgggtgaccc
cgagccaccgcccacgtcggcagaggcggccttgctgcgctctgtggcagagcagatccaacagcagcaccacttttttt
tctcctccttcgtcggctaccagggcaaccgcgtggagctgatgacacagatggtagacgccgtgctccccgatggccaa
gacctcaactggggccgcctggtgttgctcttagcctttgcggggacaattgtgagtcaagagcagagaaaccgtctgaa
ggataaaatgaaagtgctccaagactgccaactcatagtggccttgctgtgcaatcgactcctgaggcggcatcgctcct
ggctggaggctcaaggtggctgggatggcttttgtgtcatctttgggagtcccttaccactcgatttttggagcacactg
ctgatcaagacttttctgtcctgtgtcattgcaacagccatcctgtttgtctggaaaagactattataa
>gnl|bcl2dbcds|F6VJQ0_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Monodelphis domestica GN=BCL2L10 (length=570 residues).
atggattacaagtgtgctcttagggaagagacggcgcggctggtaactgactacctggaatattgttgccggagggaagg
cgtccaggagctgccggcccctacccctgctgcagctacactgcgtttggtgtcgagcgagctccgccagatttaccagg
acttcttcgagtgcgccctgaatcagctactcgaccgggaacctgagcaagtaatcgtcaacgtagcggagctcatggac
cgaggcgagttcaactggggccgggtggcggtgctagtggtttttgccggggcgctgctggagatggaggaactactgaa
agaggagcaggtactgcagcttcggagggaaacgagccggcgtctgaccgaaaaactctgcaactatctggtggagagga
agggcgcgtggctgcatgagaacggaggctggactggctttcaccaccacttcgaaaaaaggcaatctcctccaccaagt
gactcaagtaataatacactgtgctgcataatggcagcagcagcaggatttggactagtgggattagctcttttattagt
cgtacgataa
>gnl|bcl2dbcds|Q9Z0F3_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Mus musculus GN=BCL2L10 (length=576 residues).
atggccgactcgcaggacccactgcatgaacgcactagacggctgctgtctgactacatattcttctgcgcacgggagcc
ggacaccccagagccaccgcccacgtctgtcgaggcggccttgcttcgctctgtgactaggcagatccagcaggagcacc
aagaatttttttcctccttctgcgaaagccggggcaatcgcctggagctggtgaaacagatggcagataagttgctctcc
aaagaccaagacttcagctggagccaactggtgatgctcctggccttcgcggggacgcttatgaatcaaggcccttacat
ggctgtcaagcagaagagggatctggggaatcgtgtcatagtgacccgagactgctgtctcatagtgaactttctgtata
atctgctcatggggcgtcggcaccgcgccaggctggaggctctcggcggctgggatggcttttgccgcttcttcaagaat
cctttaccgctcggcttctggagaagattgctgattcaggcttttctgtcaggcttctttgcaacagccatcttttttat
ctggaaacgtttataa
>gnl|bcl2dbcds|M3Y8D1_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Mustela putorius furo GN=BCL2L10 (length=681 residues).
atgggtgtggcggcccctccctgggcggaggcgcagcgggacctagaaaaccgggtcgggtcgggcagcgcggggagagg
tcgggccatggcggacgctttgagggagcgcacggcgcagctgctgaccgactacctggagtactgcgcccgcggccccg
gcacccccgcgcggtcgccgtctacgcgcgaggccgcggtgctgcgctcggtggccgccgtcgtgcggcagcgtcacgag
cgcttcttgtcggattaccgcggctacggcggcaaccgcgtcgagctggtggctcagttggagcgggagatactcgccca
cccccaagccctaagctggggccgtgtggtggcgctcgtgaccttcgcgggaacgctgctggagcgcccgccgtcggggg
cctgctcgaacttggggccggacccggaactggaactggagctgggggagtgggaggccagcgttcgccaagactgccgg
cgcctggtggacttcctctgcggtcggctcacagggcagcaccgcgcctggctggaggcgcacggcggctgggatggctt
ttgtctcttcttcacacccgcgctgctgtcttggaaaagactgctggtccaggctcttctgtcatgctttacggcagtga
tcttaatctacttctggaaaagattaccatttattgggtga
>gnl|bcl2dbcds|G1QEX2_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Myotis lucifugus GN=BCL2L10 (length=537 residues).
gacgagttgaagttgcgcacccgacggctgctgaccgagttcctggaacaccgcacccgaaggcgcggcactgccccgca
gcagccgtccacgcccgaggccaccgtgatgcgctccctggctgctcattcgtggctgggtaccccgcactcctggtccc
ggaggcagagaaaccgactcgagcagatggtcgaccagatagagtcgctagttccagacggcacagaccccaactggttg
agcgtggtggcgctcgtgtccttcgcgggggccctgctggagagaccgccgccaggccactcgcaggcacgcagggaatg
ggatgccaccgttgaccaggactgccagcgcctggtcaccttcctgtgcagttggctcacggagacgcaccgcacctgga
tggaggcgcaaggtggctgggatggcttttgtcacaacttcatgcctgcaccgccgcctggggacagactgctggctccg
cttctgagggcatgccttgtactcataatcttaatctgcttgtggataaaaatcatg
>gnl|bcl2dbcds|G1R3W6_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L10 (length=696 residues).
atggttgaccagttgcgggagcgcaccgagcggctgctggccgactacctggggtgctgcgcccgggaacccggcacccc
cgagccgacgccgtccacgcccgaggccgccatgctgcgctccgcggccgccaggttacggcagctccacccgtccttct
tctccgcctacctcggctaccctgggaaccgcgtcgagctggtggtgctgatggcggattccgtgctctccgacagcccc
ggccccacctggggcagagtggtgacgctcgtggccttcgcagggacgctgctggagagagggccgctggtgaccgcccg
gtggaagaagtggggcttccagccgcggctaaaggagcaggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcgcctcgtggggcagcaccgcgcctggctgcaggctcagggcggctgggtgagcacgcggcggacaccg
ggacacggggcgggacgggcagccgggaagcgcccacgaggccggcacggatggcttttgtcacttcttcaggaccccct
ttccgctggctttttggagaaaacagctggtccaggcttttctgtcatgcttgttaacaacagccttcatttatttctgg
acacgattattatgagttttaaaacttttaacccgcttctacctgcacagctgtga
>gnl|bcl2dbcds|I3J363_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Oreochromis niloticus GN=BCL2L10 (length=708 residues).
atgtcgagaggcggagtcacacattctctatcagctgaagggaagactcaactgtaccgacgctctccttccgccgtctg
tatgtgcagagagcagtctgatatcgctgggaggaaaatgaaattctgtgggctgtggaaagagaccctgcttttggccg
aggactacctgtccttttgctgcacgagtccacatcaagcccctccacctcccagcgaatcagccgctgccatgaggcgt
ctgggctgggacatcgaaagacagcaccaagctcgcttcgacaacctcgctcagaccttcctggtgcagtgtgggccgga
ccactgcctcagcctcagaaaggtgatgaaggagctggttggagatggacacttgaactgggggagggttgtttctcttt
ttgcctttactggagtgctggccagaaagatcctggagcagaagccggggctggaccctgggcaacagcaggaactggga
caggagcccatgagctgcagaaggctggcagagaccatagctgattacctgggagaagagaagaaagactggctgttgga
taatgatggatgggaaggcttctgtaagttctcccgcagtgccagagaagtgagccaggactcatccatgaagaaagcgc
tgtttgctgccgccggtgtcggccttgctgggcttaccttcctcttggtcaaaggcttcagattttga
>gnl|bcl2dbcds|G1T264_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BCL2L10 (length=573 residues).
aggccccagcggaggctggccatggcagacgctttggaggagcgcactgcgcgcctgctcaccgactacctggagtgctg
cgcccgcgagcccggcacccctgagccgcagccgtccacgccggaggcggctgtgctgcgctgtgcggccacgcagcttc
agcgggtccactggcccttcttctccgtctaccgcggctaccccggcaaccgcatcgagctggcggcgcgcgtggcggag
gccgtgctctccgacggccacgacctcagctggggccgcgtggtgacgctcgtgaccttcgccgggacgcttctggacag
agggccgccggtgaccacccagcgggtgaggaggaatgaaatcgcccgggactgccagcgcttggtggccttgctgtgcg
ctcgcctcgcagggcagcaccgcgcctggctgcaggctcaaggcggctgggatggcttttgtgtcttctaccggactccc
ttaccgctgaccttctggagaagactgctggtccgcacttttctgtcctgctttgtagctacagccttactcttcgcctg
gacgcgcgtgtat
>gnl|bcl2dbcds|H2MBQ3_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L10 (length=642 residues).
agagtgataaggttctctttacgccgtctcagtgcgcagttgcttgatatcgctgggaggaaaatgtcttgtgggctgag
gaaagagaccctagctgtggccctggattacctgtccctgagctgcaggagcccactccaggcccccccacctcccagcg
agtcagctgctgccatgaggcgcctggcccaggacatggaggcgcagtaccagccccgcttctccaccttagcacagaac
ttcaggaagcacagcgggccggacctgtgctccagcctcaggaaggtgatggaggagctggtgggagatgaacgcttgaa
ctgggggagggtcgtttccctttttgcattcgtgggagtgctggcgaggcagctgagggagcaaacagacatgaacccgg
ggctggaccccgggcgggaagtggcgcccgggcctgtgagctgccaggcgctggcagaaactgtagctgatttcctggga
ggagacaagaaagaatggatgctagaaaatgatggatgggaaggcttctgtaagttctccagaacagccagagaggtgag
tcaggactcgtccatgaagactgcgctcttcgcggcggccagcgtgggcctggctggactcaccttcctcctggtgcgct
ag
>gnl|bcl2dbcds|H0WZ06_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Otolemur garnettii GN=BCL2L10 (length=576 residues).
atggcagacccgttgagggagcgcaccgagcggctgctgactgactacctggagtactgcgcgcgggatccgactgcccc
ggagccgacgccgtcctcgcccgaggccgccttgctgcgctccgtgaccgcctatatacagcagcgccactggtcctttt
tctccgcctacataggctaccccgggaatcgcgttcaggtggtggaacggatggtgaaggctatgctctcagacaaccag
agactcaactggggccgagtggtgacgctcgtgaccttcgcagggacgcttctacagaggcctccagtagaagccaggcg
ggagaagcaggacaagtcgcaactgaaggagggagaagacgaagtcgccagggattgccagcgcctagtggccctactga
gctctcggctggtggggcagcaccgcgtttggctggaggctcaaggcggctgggatggcttttgtcagttcttcaggaca
cccttaccgctagctttttggagaagattgctgttcgaagttttactgttgtgctttttagcaacggtcttcatctattt
ctggacacgacttact
>gnl|bcl2dbcds|W5QIG4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Ovis aries GN=BCL2L10 (length=582 residues).
ggtcggccccccggtagaggcggagccatggtggacccgtttagggagcgcacggcccggctgctgatggactggctgga
gttctgcgcccgggagcccggcactccagctcctgcgccgtccacgcccgaggctgctgtgctgcgccacgtggccgccc
gtgtcctggaagcaaatcgaaacgtcttgcccctataccgccgctaccgcaggcaccgcgtcgagctggtggccaggatg
gcgcagaggctgctcgacgaagaccctggccccagctggggccgcgtggcctcactcgtgaccttcgcggggtctctgct
ggagaggcagccgcagacgacccgacggcagaagagagacgacggcagcgttagcagggactgtcggctcctcgtggccc
ttctctgcgctcagttctgcgaaaggcaccgcgcctggctgatggcgaacggcggctgggatggattttgtctctccttc
agccactcattgcaaccatcttgggaaagacagctggtctggtttttcctctcatactggacagcaataatcataatcta
cttctggataaaattatcgtga
>gnl|bcl2dbcds|A0A2R9BCD9_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Pan paniscus GN=BCL2L10 (length=615 residues).
atggttgaccagtggcgtgagcgcactaccatggccgacccgctgcgggagcgcaccgagcggttgctggccgactacct
ggggtactgcgcccgggaacccggcacccccgagccgacgccgtccacgcccgaggccgccgtgctgcgctccgcggccg
ccaggttacggcagatccaccggtccttcttctccgcctacctcggctaccccgggaaccgcttcgagctggtggcgctg
atggcggattccgtgctctccgacagccccggccccacctggggcagagtggtgacgctcgtgaccttcgcagggacgct
gctggagagagggccgctggtgaccacccggtggaagaagtggggcttccagccgcggctaaaggagcaggagggcgacg
tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcgtggggcagcaccgcgcctggctgcaggctcag
ggcggctgggatggcttttgtcacttcttcaggaccccctttccgctggctttttggagaaaacagctggtccaggcttt
tctgtcatgcttgttaacaacagccttcatttatctctggacacgattattatga
>gnl|bcl2dbcds|H2Q9G4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Pan troglodytes GN=BCL2L10 (length=615 residues).
atggttgaccagtggcgtgagcgcaccaccatggccgacccgctgcgggagcgcaccgagcggttgctggccgactacct
ggggtactgcgcccgggaacccggcacccccgagccgacgccgtccacgcccgaggccgccgtgctgcgctccgcggccg
ccaggttacggcagatccaccggtccttcttctccgcctacctcggctaccccgggaaccgcttcgagctggtggcgctg
atggcggattccgtgctctccgacagccccggccccacctggggcagagtggtgacgctcgtgaccttcgcagggacgct
gctggagagagggccgctggtgaccacccggtggaagaagtggggcttccagccgcggctaaatgagcaggagggcgacg
tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcgtggggcagcaccgcgcctggctgcaggctcag
ggcggctgggatggcttttgtcacttcttcaggaccccctttccgctggctttttggagaaaacagctggtccaggcttt
tctgtcatgcttgttaacaacagccttcatttatctctggacacgattattatga
>gnl|bcl2dbcds|A0A096NM44_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Papio anubis GN=BCL2L10 (length=696 residues).
atggctgacccgttgcgggagcgcaccgagcggctcctggccgactatctggggtgctgcgcccgggaacccggcacccc
tgagccgaggccgtccacgcccgaggccgccgtgctgcgctcagcagccgccaggttacggcagctccaccggtccttct
tctccgcctaccgcggctaccccgggaaccgcgtcgagctggtggcgctgatggcggaggccgtgctctccgacagcccc
ggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgctggtgacagcctg
gtggaagaagcggagcttccagccgcggctgaaggagcaggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcagggcggctgggtgagcacgcggcggacaccg
ggacgcggggcgggacgggcatccgggaagcgcccacgaggccggcacggatggcttttgtcacttcttcaggagcccct
ttccgctggctttttggagaaaactgctgatccaggctttcctggcatgcttgttagcaacagccttcggttatctctgg
acacgattattatgagttttaacatttttaacccacttctacctgcccaactgtga
>gnl|bcl2dbcds|A0A096ME02_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Poecilia formosa GN=BCL2L10 (length=651 residues).
atgcaccgaggttctccttccgccgtctggatgtgcagagagccgtcacatatcgctgggaggaaaatgtcctgtgggct
gtggaaagagaccgtggctgttgcagaggattacatccacctgcgctgctcaagcccacacccagcccctccacctccca
gcgagccggctgccgccatgaggcgcctggcccaggacgtggaggcccagcaccaggctcgctttcactccctggcccag
ggcttcctgaagcactgcgggacagacctctgctccaacctcagaaaggtgatggatgagatggtgggagatggacattt
taactgggggagggtggtgtccctcttcgccttcgctggcgtgctggccagacagctgcgggaacagacgggcaagaacc
cggggccggactccgggaagcagcaggaactgcaacaagagcccgtaagctgccgggcgctggcggagaccattgctgat
tacctggagaagcacaaaaaagactggctgcaggaaaataatggatgggacgggttttgtagctacgcccacaacgccag
agaagtaagtcaggactcctccatgaagacggcgctggttgctgtcgccggagtcggcatcgcagggctcaccttccttc
tggtgcgctag
>gnl|bcl2dbcds|H2NN92_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Pongo abelii GN=BCL2L10 (length=615 residues).
atggttgaccagttgcgggagcgcactatcacggccgacctgctgagggagcgcaccgagcggctgctggccgactacct
ggggtgctgcgcccgggaacccggcaccccagagccgacgccgcccacgcccgaggccgccgtgctgcgctccgcggccg
ccaggttacggcagctccaccggtccttcttctccgcctacctcggctaccccgggaaccgcgtcgaactggtggcgctg
atggcggattccgtgctctccgacagccccagccccacctggggcagagtggtgacgctcgtgaccttcgcagggacgct
gctggagagagggccgctggtgaccgcccggtggaagaagtggggcttccagccgcggctaaaggagcaggagggcgacg
tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcgtggggcagcaccgcgcctggctgcaggctcag
ggcggctgggatggcttttgtcacttcttcaggaccccccttccgctggctttttggagaaaacagctggtccaggcttt
tctgtcatgcttgttaacaacagccttcatttatctctggacacgattattatga
>gnl|bcl2dbcds|A0A2K6F2Q2_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Propithecus coquereli GN=BCL2L10 (length=579 residues).
atgggtgaccggttcagggagcgcaccgagcggctgctggccgactacctggagtactgcacaagggagccgggcgcccc
ggggctgccgccgtcctcgctcgaggccgccgcgatgcgcttcgcagccaccaagatacggcggaagcacgcgtccttct
tctccgcctacgtcggctaccccgggaaccgcgtctacctgctggagcggatggcggaggccgtgctctgcgacagcctc
agctggggccgggtagtgatgctcgtgaccttcgcagggacgcttctagagagagggccgccggtgaccgcctggtggaa
gaagtggggcctccagccgcagccgaaggagggggatcccgaagtcgcccgggaccgccagcgcctggtggccctgctgt
gcgcccggctggcggggcagcaccgcgcctggctgcaggctcaaggcggctgggatggcttttgtgacttattcaggaaa
cccttgccgctagctgtttggaggagactgctggtccaggttcttttgtcatgctttttagcaacgaccgtcatctattt
ctggacacgattattatga
>gnl|bcl2dbcds|Q99M66_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2L10 (length=558 residues).
atgggtgacccgctgcaggatcgcactagacggctgctgactgactacatattgttctgcgcacgggcgccgaacacccc
tgagccactgcccacgtctgttgaggcggccttgctgcgctctgtgactagtcagatccaacaggagcaccaggatcttt
tcaactccttccgcgactaccagggcaaccgcctggagctggtgacacagatggcggatgagttgctctccaatgaccaa
gagttcaactggggccgcctggtgatgctcctggccttcgtggggacgctaatgaaccaagacaggactgttaagcggag
gagggatcaaagaaaccgtctcctactggagcgagactgctatctcatagtgagcttgctgtacaatcgactcacaggac
ggcatcgctcctggctggaggctcacggtggctgggatggcttttgccaattcttcaagaaccccttaccacccggcttc
tggagaagattgctgatccgggctattctgtcctgtttctttgcaacggccatcttttatatctggaaatgtttataa
>gnl|bcl2dbcds|A0A2K6M5H5_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Rhinopithecus bieti GN=BCL2L10 (length=615 residues).
atggctgacccgttgcgggagcgcaccaccgtggctgacccgttgcgcgagcgcaccgagcggttgctggccgactatct
ggggtgctgcgcccgggaacccggcacccccgagccgaggccgtccacgcccgaggccgccgtgctgcgctccgcggcgg
ccaggttacggcagctccaccggtccttcttctctgcctacctcggctaccccgggaaccgcgtcgagctggtggcgctg
atggcggaggccgtgctctccgacagccccggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgct
gctggagagagagccgctggtgacagcctggtggaagaagcggagcttccagccgcggctgaaggagcaggagggcgacg
tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcacggggcagcaccgcgcctggcttcaggctcag
ggcggctgggatggcttttgtcacttcttcaggaccccctttccgctggctttttggagaaaactgctgatccaggcttt
cctggcatgcttgttaacaacagccttcggttacctctggacacgattattatga
>gnl|bcl2dbcds|A0A2K6R5T5_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL2L10 (length=696 residues).
atggctgacccgttgcgcgagcgcaccgagcggttgctggccgactatctggggtgctgcgcccgggaacccggcacccc
cgagccgaggccgtccacgcccgaggccgccgtgctgcgctccgcggcggccaggttacggcagctccaccggtccttct
tctctgcctacctcggctaccccgggaaccgcgtcgagctggtggcgctgatggcggaggccgtgctctccgacagcccc
ggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgctggtgacagcctg
gtggaagaagcggagcttccagccgcggctgaaggagcaggagggcgaggtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcggctcacggggcagcaccgcgcctggcttcaggctcagggcggctgggtgagcacgcggcggacaccg
ggacgcggggcgggacgggcatccgggaagcgcccacgaggccggcacggatggcttttgtcacttcttcaggaccccct
ttccgctggctttttggagaaaactgctgatccaggctttcctggcatgcttgttaacaacagccttcggttacctctgg
acacgattattatgagttttaaaatttttaacccacttctacctgcccaactgtga
>gnl|bcl2dbcds|A0A2K6TIT7_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L10 (length=687 residues).
atggctgacccgctgcagcagcgcaccgagcagctggtggcggactacctggagtactgctcccgggagcccggcacccc
cgagtcgccaccggccacggccgaggccgctgtgctgcgcgccacggccgccgttgtacggaaactctacccgtccttct
tctccgcttaccgcggctaccccaggaaccgcgtcgagctggtggcgaggatggcggaggccttgctctccgacagtccc
ggtcccacctggggcaacgtggtgatgctcctggccttcgcggggacgctgctagagagggggccgctggtgaccgcccg
gtggaagaagtggggcttccagtcgcggttgaaggagccggagggcgacgtcgcccgggactgccagcgcctggtgggct
tgctgagctcgcggctcgtggggcagcaccgtgcctggctggaggctcagggcggctgggtgagcacgcggaggaggacg
tggggcgggatgggcacctgggaagggcccgccaggtggggtatttttctcctgtgcctattaaatgacctcctactcgc
tggcatggagaaaactgctggtcccggttttcctgtcatggttgttaacagcagcattcatctacttctggacacgataa
ttaggagttttaaaatttttagcccacttctgcctgcccaactgtga
>gnl|bcl2dbcds|F1RZB9_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Sus scrofa GN=BCL2L10 (length=555 residues).
atggcggacgcgttcagggagcgcacagcccggcttctgaccgactacctggagtactgcgcccgggagcccggcaccgc
cgcgcggcagccgtcctcgcccgaggccgcagtgctgcgttgcgtggctgcccagatacgggagtacaacgtgcgcacct
tgtctgtctaccgcggcttccgctggaaccgtgtcgaattggtggcctggatggcacagaaactactcgcaagcccacgt
ggccccaactggtaccgcgtggcatcactcttgaccttcgcagggatgctgctggaaagacatcctcgggaggcctgtgg
gcggaagaagaaggagggcaacgttagcagggactgccgactcctggtggctttgctgtgcgctcagctctcagggcagc
atcgcacctggctattggcgaacggcggctgggatggattttgtctcttcttccaaggttcattgcaacaaacttggaca
agacacatggtctgggtttttgtgtcatactgtacagcagtggtcttactctacttgtggagaaaattattgtga
>gnl|bcl2dbcds|A0A1U7UZD8_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Tarsius syrichta GN=BCL2L10 (length=588 residues).
atggccgacccgctggaggagcgtaccgcgcggctgctggctgactacctggagtactgcgcccggccgcccggcagccc
cgagccgcggccgtcctcgcccgaggccgccgtgctgcgctccacggccgccaggctgcggcagcggcacgcctccttct
tctcggccttcgttgactaccccgggagccgcgtggacctgacggcgcggatggccgatgccgtgctctctggcagccgc
gacctcagctggggccgcgtggtgacgctcgtgaccttcgcggggacgcttctggagcgaggaccgctgctgcccgccgg
ggggcagcagcggggcttcaggccccggcggaagaaggaggagggcgacgttgcgcgggactgccagcgcctggtggcct
tgctgagcgcgcggctcgcggggcggcaccgcgcctggctgcaggctcaaggcggctgggatggcttttgtgtcttcttc
agtacacccttaccactaactttttggagaagactgccggttcaggcgtttgtgtcatgccttttagcaatggccttcat
ctattttttctggacacgattattatga
>gnl|bcl2dbcds|M4AUW7_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Xiphophorus maculatus GN=BCL2L10 (length=651 residues).
atgcgccgaggttctccttccgccgtctggatgtgcagagagccgtcacatatcgctgggaggaaaatgtcctgtgggct
gtggaaagagaccgtggttgttgcagaggattacatccgcctgcgctgctcaagcccacacccagcccctccacctccca
gcgagccggccgccgccatgaggcgcctggcccaggacgtggaggccaagcaccaggctcgctttcactccctggcccag
ggcttcctgaagcactgcgggtcggacctctgctccaacctcagaaaggtgatggatgagatggtgggggacggacactt
taactgggggagggtggtgtccctcttcgccttcgccggcgtgctggccagacagctgcgggaacagacgggcaagaacc
cggtgccggactccgggaagcagcaggaactgcaacaagagcccgtaagctgccgggcgctggcggagaccattgctgat
tacctggagaagcacaaaaaggactggctacaggaaaataatggatgggaagggttttgtagctatgcccgcaacgccag
agaagcaagtcaggactcctccatgaagacggcgctggttgctgtcgccggggtcggcatcgctggactcaccttcctcc
tggtgcgctag
© 1998-2018