Dataset for CDS BCL2L1 of organism all

[Download (right click)] [Alignment] [Repertoires]

114 sequence(s)

>gnl|bcl2dbcds|U3IS71_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Anas platyrhynchos GN=BCL2L1 (length=681 residues).
atgtccagcggcaaccgggagctggtgatcgactttgtctcctacaagctgtcgcagaaaggctacagctggagccagct
ggaggaagaggatgagaacaggactgagttggcttccgaggccgccgcggtgctcaacgggagcccctcctggcaccccc
cagctggccaggtagtgaacggcgccgccgtgcaccggagcagcctggaggtccacgagcttgttcaatcggccgccgtc
cggcaggctctgcgcgaagccggggatgaattcgagctgaggtaccgccgggctttcagcgacctcacctcccagctcca
catcacccccggcacggcttaccagagcttcgagcaggtggtgaacgaacttttccgcgatggggtgaactgggggcgca
tcgtggccttcttctccttcggaggggcgctgtgcgtggagagcgtggacaaggagatgagggtcctggtggggcgcatc
gtggcctggatgaccacctaccggagggcagagctggagaaagcattttctgagggaggagggatggagcggtttgtgga
cctctacgggaacgatgctgctgcggagatgaggaagggccaggaaaccttcaacaaatggctcctgaccggggccacgg
tggccggagtgctcctgctgggatccctgctgagcccaagt
>gnl|bcl2dbcds|H9GHK7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Anolis carolinensis GN=BCL2L1 (length=630 residues).
atgtcgagcagtaaccgagcgctcgtggtggacttcctttcctacaagctgtcgcagcggggccacagctggcatgagat
tgagatggagagcggggaggaagcgatggagccagcaaacgagacggggaacaccctcaatgggagcccttcttggcatc
ccagccccagccatgtcatcaatggggcctcagaacaccccgaactccttgaagaggaggaggaagaaaacccgagggtg
gatgtcagccagacacttagggaggctggcgatgagtttgaactaaggtaccggcgggcttttagtgacctgacctccca
gctccacatcaccttgggcacggcataccagagcttcgagcaggtggtgaatgaactcttccacgatggggtaaactggg
ggcggatagtggcattcttctcctttgggggagccctgtgcgtggagagcgttgacaaagagatgcaagggttggtggtg
aggattgccagctggatgaccacgtacctgactgaacacctggacccctggatccaagaaaacggtggctggaaatcaaa
ggggggacaaatcatttcagttatctacacgcatcattccgaagtctgtctgaacacttacattgattga
>gnl|bcl2dbcds|A0A2K5EBP4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcactgagggaggcgggcgacgaatttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|A0A2K5EBP4_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L1 (length=441 residues).
atgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatgctccacat
cacccccgggacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatggggtaaactggggtcgcattg
tggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
gcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaact
ctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtgg
ccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|E2IV75_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Aotus vociferans GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcactgagggaggcgggcgacgaatttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|Q05KJ0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bos taurus GN=BCL2L1 (length=702 residues).
atgtctcagagtaaccgggagctggtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggacagaatcagatatggaaacccccagtgccatcaatggca
acgcatcctggcacctggcggatagccctgctgtgaatggagccactggccacagcagaagctcggatgcccgggaagtg
atccccatggcagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacgtcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|F7IT34_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagcccagtggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcactgagggaggcaggcgacgagtttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|F7IT34_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L1 (length=444 residues).
atgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggcaaccca
tcctggcacctggcggacagcccagtgctttgaacaggtagtgaacgaactcttccgggatggggtaaactggggtcgca
ttgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
gcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtgga
actctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactg
tggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|F7IT34_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagcccagtggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcactgagggaggcaggcgacgagtttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|Q76LT7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcagacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaaacaagcgctgagggaggctggggatgagtttgaactgaggtaccggcgggcattcagtga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A1L5BWY3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Castor fiber GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaataggactgaggccccagaagggattgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatgacagcagtgaagcaagcgctgagggaggcaggtgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacataaccccggggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggctacttacctgaatgaccacctagaaccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcagcagctgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A286Y5D6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cavia porcellus GN=BCL2L1 (length=702 residues).
atgtctcaaagcaactgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaaggcccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacctaactgatagtcccacggtgaatggggccactggccacagcagtagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagctcttagggaggcgggcgatgagtttgaacttcggtaccggcgagcattcagcga
cttaacatctcagctccacatcaccccggggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcattgtgcgtggagagcgtagacaaggagatgcag
gtattggtgaggcggatcgcaagctggatggctacttacctgaatgaccacctagaaccttggatccaggacaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tgctgacgggcgtgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5M8B1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cercocebus atys GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5M8B1_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Cercocebus atys GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtgaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A0D6DR75_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Channa striata GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtggtttactacataacatataaactgtcggagaaaaactatcctctcaaccacttggg
actcagtgagcctccaaacaggactgatggaggggaggttgagtccgctgaggaacagcggatagcgacgcacgccaacg
gtacttttaacggaagaagtcctggaacccccccagcatccccgctcaggcaacaacggttgccatcaccgacgagcctg
gatgcggtgaaagaggccctccgggactcagccaatgagtttgagctgcgatatgcccgcgccttcagcgatctgcacaa
ccagctgcatatcacgcccgccacggcctaccaaagctttgcgaacgtcatggatgaagtgttccgggacggcgtcaact
ggggccgcatcatagggctctttgcatttggtggggcactgtgtgttgagtgtgtggagaaggagatgagtcagctggtg
gtcaggatcgtagagtggatgacagtgtacctggacgaccacattcagccctggatccaaagtcaaggaggatgggagca
ctttgctgaaatcttcgggcatgatgcagctgcagagagcaggaggtctcaggagagtttcaagaagtggctgctggcgg
ggatgacggtggtgacgggcgttgtggctggtgctcttatcgcgcaaaaacgcctgtga
>gnl|bcl2dbcds|A0A0D9RJZ8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Chlorocebus sabaeus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaaacgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A059PJI5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Clarias batrachus GN=BCL2L1 (length=717 residues).
atgtcttactacaacagagaacttgtcgtgtacttcatcaagtacaagctctcccagaaaaactacccctgcgaccacat
cggcctcacggaagaggtgaacggccaggtggcggaagagaacgcggtgggagcgggagagtcggagacgccgacagcag
tcgttaatggcaccctaaacgggaccggatcggcaggcactccaccgcgatcgccgactttgtcccctcagaggcaggtg
aatggcagcgcaagcctggaggcagtaaaggaggcgctacgtgactctggcaatgagttcgagctgcgctattcacgcgc
ctttagcgacctgtcatcacagttgcatataactccagtcacggtgtaccagagctttgagagcgtgatggacgaggtgt
tccgcgacggcgtcaactggggccgtatcgtgggcttgttcgcttttggaggtgccctctgtgtcgagtgtgtggaaaag
gagatgagtccgctggtggcacgtatcgccgagtggatgaccgtctacctggacaaccacatccagccctggattgaaga
gcaaggaggatgggaacggtttgcagagatctttgggaaagatgcagcagcagaaggcagaaggtcacaggaaagcttta
agaagtggctgctggcaggtgtgacactcttcacgggggtggtggtgggctccttcatcgctcagaagcgcctgtaa
>gnl|bcl2dbcds|A0A2K5H963_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctagtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagctgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5H963_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcaact
tggatggccacttatctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
tgggaacaatgcagcagctgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|B2Z3Z4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cricetulus griseus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctagtggttgactttctctcctacaagttctcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaacaggactgaggccccagaaggaactgaatcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtaaatggagccactggccacagcagcagtttggatgcacgggaggtg
atccccatggcagccgtaaagcaagcgctgagagaggccggcgatgagtttgagctgcggtaccggcgggcgttcagtga
tctaacatcccagcttcatataaccccagggactgcatatcaaagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggtggagccctctgtgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggacaacggcgg
ctgggacactttcgtggaactctacggaaacaatgcagcagctgagagccggaaaggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctctctcttcagtcggaagtga
>gnl|bcl2dbcds|Q90Z98_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Danio rerio GN=BCL2L1 (length=717 residues).
atgtcttactataaccgagaactggtggtattttttatcaaatataaactctcgcagaggaactacccctgcaaccacat
tggacttacagaagacacaaatcggactgatggggctgaagagaatggcgagggggcagcaggagcgacaactcttgtta
atggcaccatgaatagaacgaacgctagttccactgggaccccaccacaatcccctgcttcatccccccagcgtcaaaca
aatgggtctgggggtctagacgcagtgaaggaggcgctccgtgattctgccaacgagtttgagctgcgctattccagagc
attcaacgatctttcctcacagctccacatcacacccgccacagcgtaccagagcttcgagagcgtgatggatgaggtgt
ttcgcgacggcgtcaactggggccgaatcgtggggttgttcgcattcggaggggctctgtgcgtcgagtgtgtggagaag
gagatgagtccgcttgtgggacgcatcgcagaatggatgaccgtctacctagacaaccatattcaaccctggatccaaag
ccaaggaggatgggaacgctttgcagagatctttggaaaagatgcagcggcggaaagcaggaaatcgcaagaaagcttca
agaaatggttgtttgcaggaatgaccttgctcacgggtgtcgtcgttgggggactcattgcacagaaacgcctgtga
>gnl|bcl2dbcds|Q90Z98_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Danio rerio GN=BCL2L1 (length=717 residues).
atgtcttactataaccgagaactggtggtattttttatcaaatataaactctcgcagaggaactacccctgcaaccacat
tggacttacagaagacacaaatcggactgatggggctgaagagaatggcgagggggcagcaggagcgacaactcttgtta
atggcaccatgaatagaacgaacgctagttccactgggaccccaccacaatcccctgcttcatccccccagcgtcaaaca
aatgggtctgggggtctagacgcagtgaaggaggcgctccgtgattctgccaacgagtttgagctgcgctattccagagc
attcaacgatctttcctcacagctccacatcacacccgccacagcgtaccagagcttcgagagcgtgatggatgaggtgt
ttcgcgacggcgtcaactggggccgaatcgtggggttgttcgcattcggaggggctctgtgcgtcgagtgtgtggagaag
gagatgagtccgcttgtgggacgcatcgcagaatggatgaccgtctacctagacaaccatattcaaccctggatccaaag
ccaaggaggatgggaacgctttgcagagatctttggaaaagatgcagcggcggaaagcaggaaatcgcaagaaagcttca
agaaatggttgtttgcaggaatgaccttgctcacgggtgtcgtcgttgggggactcattgcacagaaacgcctgtga
>gnl|bcl2dbcds|E6ZFR0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Dicentrarchus labrax GN=BCL2L1 (length=663 residues).
atgtcgtacagtaacagagagctggtggagttctttataagctataaactgtctcagaggaaccacccaacctctctact
gaggccggagaatgccggtgaaaggactgagggagacaaggccaactcagctgccagaaacggcttgctggccagcaaga
acacaagtggccagccggggacgtcttcgtcctcaggcgctgacatagaggctgtaaaggcagctcttcgggactcggca
gatgagtttgaactgctcttcacgcaagcgtttagtgacctttcctcgcagattgacatcactcctgacacggcctacca
cagctttaaaagcgtgatggacgaggtgttcaaggatggagtgaactggggacgtatagtgggcctgtttgcctttggcg
gtgtactgtgtgtagaatgtgtcgagaaagatatgagtgagctggtttcccgcatcgcagactggatgaccatgtacctg
gatgagcacatcagtccgtggatccagagccaaggaggatgggactgctttgctgaggtttttgggcgagacgccgccgc
agaagcgaggagatctcgggagactctgagtagatggctgctaattggggtggcgctgctaatgggagctgtggtcgggg
ttctcattgctaagaaacattga
>gnl|bcl2dbcds|A0A1S3EPX7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Dipodomys ordii GN=BCL2L1 (length=705 residues).
atgtctcagagcaaccgtgagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagagcaggactgaggacccagaaggaactgaatcggagatggagacccccagtgctatcaatggca
acccatcctggcacctggcggacagccccgcggtggtgaatggagccacgggtcacagcagcagttcggaagcccgggaa
gtgattcccatggcagctgtgaagcaagcgctgagggaggcaggcgatgagtttgaactgcggtatcgacgggcattcag
tgacctgacatcccagctccatattaccccggggacagcatatcagagctttgagcaggtagtgaacgaactcttccggg
atggggtaaactggggtcgaattgtggcctttttctccttcggcggggcactgtgtgtggaaagcgtagacaaggagatg
caggtattggtgagtcggatcgcaagttggatggccacttacctgaatgaccacctagagccttggatccaggagcacgg
cggctgggacacttttgtggaactctacgggaacaatgcagcagctgagagtcggaagggccaggagcgcttcaaccgct
ggttcctgacgggcatgaccgtggccggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A219P0Y3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Epinephelus coioides GN=BCL2L1 (length=699 residues).
atgtgtcaaaacagagaactggtggtttgctacataaaatataaactaacccagagaaactatcctctcaaccacatggg
actcatagagcctccaaacaggactgatgggggggaggcagggttaggtgaggagcagcgggtagcgacacacgccaacg
ggacttttaatggcatgagtcccgggaccccgccagcatccccgctgcggcagcaacagttgccatcaacaacgagcctg
gacgcggtgaaagaggccctccgggactccgccaacgagtttgagctgcgatacgctcgcgccttcagcgatctgcacca
ccagctgcacatcacgccggccacagcctaccaaagcttcgagaacgtgatggatgaggtgttccgggacggagtcaact
ggggccgcatcgtagggcttttcgctttcggcggggcgctgtgcgtggagtgcgttgagaaggagatgagtccgttggtg
ggcaggatcatagagtggaagacccgctatctggacaaccacattcagccctggatccagagccaaagaggatgggagcg
cttcgccgaaatcttcgggcaggacgcggcggcagagagcaggaggtctcaggagagtttcaaaaagtggctgctggcgg
ggatgaccctggtgaccggagttgtggtgggctcactcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|F6WQI0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Equus caballus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacaactggagtcagtt
tagtgacgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccacggggaatggagccactggccacagcagcagcttggatgcccgggaagtg
atccccatggcagcagtgaagcaagcgctgagggaggcaggcgatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacctggatggccacttacctgaatgaccacctagagccttggatccaagagaacggcgg
ctgggacacctttgtggaactctacgggaacaacgcggcagccgaaagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcactcttcagtcggaagtga
>gnl|bcl2dbcds|A0A1S2ZQT6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Erinaceus europaeus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggcctcagaaggaactgaatcagagatggaaacacccagtgccatcaatggca
acccatcctggcacctggcggacagccctgcattgaatggagctactggccacagcagcagcctggatgcccgggaggtg
atccccatggcagccgtgaagcaagcgctgagggaggcgggtgatgagtttgaactaaggtatcggcgggcattcagtga
cctgacttcccagctccacatcaccccagcaacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaatggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagctgagagccgaaagggacaggagcgcttcaaccgctggt
tcctgacgggcgtgactgtggctggcttggttatgctgggctcactcttcagtcgaaaatga
>gnl|bcl2dbcds|M3XA94_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Felis catus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaagcaggcgctgagggaggccggggatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcggccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|Q8SQ42_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Felis catus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcggtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcagacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtcaaacaagcgctgagggaggctggggatgagtttgaactgaggtaccggcgggcattcagtga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgctccaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|U3JSL7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ficedula albicollis GN=BCL2L1 (length=693 residues).
atgtacagcagtaatcgggagttagtgattgactttgtttcttacaagctctcacagaaaggctacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcaggggaggaggacgagatggacggcgtgctcaacggaagcccctcct
ggcacgcacccaccagccacatagtgaacggagcctccgtgcaccagagcagcctcgaagtccatgagatccgtcgagca
gccgacgtgaggcaggcgctgagagaggcgggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcacttc
ccagctccacatcactcccagcacagcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgttaaggagatgcgggtattggtg
aaacgcatcgtgtcttggatgaccacgtacttgaccgaccacttagatccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacgatgctgctgccgaggtgagaaaaggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggccggagtgcttctgctgggatcgctgctgagccgcaagtga
>gnl|bcl2dbcds|D2ITA2_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Gadus morhua GN=BCL2L1 (length=684 residues).
atgagcattgacacaagcatgtcgatcagtaacagagaactggtgttcttcttcctaagccataaactgtctcagaggaa
ttacaggcctattcccttccagcccgagggggcaggtgaggggactgatgaggacaagtccaacaggattggtaataatg
ggttacggttgaacgacggtaacggcaatggccagttggcgccatcacctactccacaaggcacggaggctgtgagggca
gcgcttctagaatcggtggaagagtttgagttgcgctacacgctggccttcagcgacctgtcgtcccagctgcccatcac
ccccgccacggcctacggtagcttcgaaagcgtgatggacgaggtgttcagggacagcatcaactggggacgcatagtgg
gcctgtttgccttcgggggggccctctgcgtggagtgtgtggagaaggagatgagccacatggtgccccgcgtggcagag
tggatgaccaggtacctggacgaccacattgaccactggatccagagcaacggaggatggaaacactttgctgcggtttt
tggaagcgacgcggcagcgggagcgaggcgtacccgggacagtcacaggagatggatgctggtgggcgcggcgctgctga
ctggggtgctgctcggggctctgctcgccaagaaacatgtctag
>gnl|bcl2dbcds|Q07816_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Gallus gallus GN=BCL2L1 (length=573 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagagggggcactgctggagcgagct
ggaggaagaggatgagaacaggactgacactgcagctgaggcagagatggacagcgtcctcaatgggagcccatcctggc
acccccctgccggccacgtagtgaacggagccaccgtgcaccggagcagcctggaagttcatgaaattgttcgagcatcc
gacgtgaggcaggcgctgagagatgcgggggatgagtttgagctgaggtaccggagggctttcagcgacctcacctccca
gctccacatcacccctggcacggcgtaccagagctttgagcaggtagtgaatgaactcttccatgatggtgtgaactggg
ggcgcatcgtggctttcttctccttcggaggggctttgtgcgtggagagcgtggacaaggagatgcgggtactggtggga
cgcattgtgtcttggatgaccacgtacttgaccgaccatctagatccctggatccaggagaatggcggctgggtaagaac
tgctctcccatag
>gnl|bcl2dbcds|Q07816_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gallus gallus GN=BCL2L1 (length=690 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagagggggcactgctggagcgagct
ggaggaagaggatgagaacaggactgacactgcagctgaggcagagatggacagcgtcctcaatgggagcccatcctggc
acccccctgccggccacgtagtgaacggagccaccgtgcaccggagcagcctggaagttcatgaaattgttcgagcatcc
gacgtgaggcaggcgctgagagatgcgggggatgagtttgagctgaggtaccggagggctttcagcgacctcacctccca
gctccacatcacccctggcacggcgtaccagagctttgagcaggtagtgaatgaactcttccatgatggtgtgaactggg
ggcgcatcgtggctttcttctccttcggaggggctttgtgcgtggagagcgtggacaaggagatgcgggtactggtggga
cgcattgtgtcttggatgaccacgtacttgaccgaccatctagatccctggatccaggagaatggcggctgggagcgctt
tgtggatctgtatgggaacaacgctgctgccgagctgaggaagggccaggagaccttcaacaaatggctcctcaccgggg
cgaccgtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|Q07816_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Gallus gallus GN=BCL2L1 (length=690 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagagggggcactgctggagcgagct
ggaggaagaggatgagaacaggactgacactgcagctgaggcagagatggacagcgtcctcaatgggagcccatcctggc
acccccctgccggccacgtagtgaacggagccaccgtgcaccggagcagcctggaagttcatgaaattgttcgagcatcc
gacgtgaggcaggcgctgagagatgcgggggatgagtttgagctgaggtaccggagggctttcagcgacctcacctccca
gctccacatcacccctggcacggcgtaccagagctttgagcaggtagtgaatgaactcttccatgatggtgtgaactggg
ggcgcatcgtggctttcttctccttcggaggggctttgtgcgtggagagcgtggacaaggagatgcgggtactggtggga
cgcattgtgtcttggatgaccacgtacttgaccgaccatctagatccctggatccaggagaatggcggctgggagcgctt
tgtggatctgtatgggaacaacgctgctgccgagctgaggaagggccaggagaccttcaacaaatggctcctcaccgggg
cgaccgtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|G3NJY1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gasterosteus aculeatus GN=BCL2L1 (length=573 residues).
atgtctcaaaacagagaactggtggttttctacataaactataaactctcccagaggaacttacccctcaaccacatagg
gctgtccgagcctcccaacaggactggcgggggggtagaggcaggggcggctggtgggcagcggggagcgacgcactcca
acgggactttcaacggcacgagtcccgggaccccgccggcgtccccgctgctccagcaacggtcgccgtcgacggcgagc
ctggatgcggtgaaggaggccctgcgggactcggccaacgagttcgagctgcgatacgctcgggccttcagcgatctgca
caaccagctgcacatcacgccggccacggcctaccagagcttcgaggacgtgatggacgaggtgttccgggacggcgtca
actggggccgcatcgtggggctgttcgccttcggcggggcgctgtgcgtggagtgcgtggacaaggagatgagtccgctg
gtgggcaggatcgtcgagtggatgacgctctacctggacaaccacattcagccctggatccagaaccagggaggctggcg
ttcagacatttga
>gnl|bcl2dbcds|G3P7B4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gasterosteus aculeatus GN=BCL2L1 (length=663 residues).
atggcgaacattaacagggagctggtggagttcttcctaagctacaagctgtctcagaagaaccacccaacctctctgtt
gaggccggaggatgccggcggaaggacggagggagacaaggccaactcggcgtccgttcctggacgcgggagcagcgccg
gccagccggggatgtcgtcgccaccgccgccaccgtccggtgacaccgaggccgtaaaggcagctcttcaggactctgcg
aatgagtttgagctgctcttcacgcaagcgttcagtgacctctccttgcagctagacgtcacccccgacacggcctacca
cagcttcaagagcgtgatggacgaggtgttcaaggatggcgtcaactggggccgcgtggtgggcctgtttgccttcggcg
gcgtgctctgcgtggagtgcgtagagaaggacatgaccgagctggtgtcccgcatcgcggactggatgaccacgtacctg
gacgagcacatcagtgcttggatccagagccagggaggatgggactgttttgctgacattttcgggcgggacggcgcggc
agcggcgaggagatctcaggagacgatgagaaggtggctgctcgtcggggtggcgctgctaatgggagtgctcgtcggta
tggtcatggtcaagaagcggtga
>gnl|bcl2dbcds|G3RY91_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggatacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|G3RY91_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctataagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|Q07817_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Homo sapiens GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcagacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|Q07817_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Homo sapiens GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcagacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|Q07817_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Homo sapiens GN=BCL2L1 (length=513 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcagacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggatacttttgtggaactctatggga
acaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggttcctgacgggcatgactgtggccggcgtg
gttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A287CZ07_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2L1 (length=675 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagaacaggactgaagccccagaagggactgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcatctggccgacagccccgcgataaatggagccactggtcacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcattgagggaggcaggcgacgagtttgaactgtggtactggcgggcattcagtga
cctgacgtcccagctccacatcaccctggggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcacattgtggcctttctctcctttggcggggcactgtgcatggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatgccttggatccaagagaacggcggctgggacacttttgtggaactctacag
gaataatgcggcagcagagagccggaagggccaggagcgcttcaaccgttggttcctgacgggcatgactgtggccggtg
tggttctgctgggctcacttttcagtcggaaatga
>gnl|bcl2dbcds|I3MUP5_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagaacaggactgaagccccagaagggactgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcatctggccgacagccccgcggtaaatggagccactggtcacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcattgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacgtcccagctccacatcaccccggggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaataatgcagcagcagagagccggaagggccaggagcgcttcaaccgttggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcgcttttcagtcggaaatga
>gnl|bcl2dbcds|I3MUP5_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagaacaggactgaagccccagaagggactgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcatctggccgacagccccgcggtaaatggagccactggtcacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcattgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacgtcccagctccacatcaccccggggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaataatgcagcagcagagagccggaagggccaggagcgcttcaaccgttggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcgcttttcagtcggaaatga
>gnl|bcl2dbcds|I3MUP5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagaacaggactgaagccccagaagggactgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcatctggccgacagccccgcggtaaatggagccactggtcacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcattgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacgtcccagctccacatcaccccggggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaataatgcagcagcagagagccggaagggccaggagcgcttcaaccgttggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcgcttttcagtcggaaatga
>gnl|bcl2dbcds|H3ANS8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Latimeria chalumnae GN=BCL2L1 (length=720 residues).
aaaatgtccttcaacaggttgctggtggtggaccatatatcccagaagctgatgcagcggggataccagtggagggaggt
tggtgagcaggaccacggtggtggaggagaccgcgcgagggaagcacagactcccgaggagggggccattccaggcatgg
acccacccaacggcagccaccctcatgcaggactcaatggtgcggttaacgggttgccggctggcagcagcagccgcctg
gaagcccaggcggtgtcggggcccgaagccgtgaaacggacattgcgagaggccggggaagagtttgagctgaggtatag
ccgagcattcagtgacctctcttcccagctccacatcacccccggcacagcctaccagagctttgaacaggtggtgaacg
aactcttccgggacggagtgaactgggggcgcgtggtggctttctttgcctttggaggggcgttgtgtgtggagagtatg
gacaaggagatgtcttcactagtagagcggatcgctgagtggatgacgacttacctagatgataacttaaacccttggat
tcaggaacaaggaggatgggcaaccataatacacattgacggggttgacgctatgcagcgctcaaacaccaggagtgaaa
aattgggttttgttgggttttttttttcctttcttctgcgtggggtggaaagaaacctcaaactctttttgcgcaaatga
>gnl|bcl2dbcds|E2IV76_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Lemur catta GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tatcgatgcagaagagaacaggactgaggccccagaagggactgaatcggagatggaaacccccagtgccattaatggca
acccatcctggcacctggcagacagccctccagcgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccctatggcagcagtgaagcaagcactgaaggaggcgggcgatgagtttgaacttcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccctagggacagcatatcaaagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggccctatgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggctggcgtggttctgctgggctcgcttttcagtcggaaatga
>gnl|bcl2dbcds|W5MG74_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Lepisosteus oculatus GN=BCL2L1 (length=669 residues).
aagatgtcatacagcaacagagacctcgtcgtctactacatcaactataaactctcgcagaagaactactcctgggacca
gttcagcctggagggcaggaccggaggcgctgaggcggtgggttcggggagcccgaacgcagaggagcgtacgaacggcg
cggccaatggcgggggggggcccgtgtcgcgccagcccccccaggggatcgaggcggtgcagggggcgctgcgcgactcc
gccaacgagtttgagctccgctacggccgggcgttcagcgacctgtcctcccagctccacatcacgcccgccaccgccta
ccagagcttcgagcacgtcatggacgaggtcttccgggacggggtgaactgggggcgcatcgtggggctcttcgctttcg
ggggtgcgctgtgcgtggagtgcgtggagaaggagatgagcaacctggtgagccgcatagccgagtggatgaccgtctac
ctggacaacaacattcagccctggatccagagtcagggaggatgggacaggtttgcggagatctttggcaaggatgcggc
tgcggagtaccggagatcacaggagagcttcaagaagtggctgctggcgggcatgactctggttacggggctggtggtgg
gctcctacatcgccaagaaacgcttatag
>gnl|bcl2dbcds|Q4U2V6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Lonchura striata GN=BCL2L1 (length=693 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagaaaggatacagctggagtcagct
ggaagaggaggatgagaacaggactgactttgcaggggaggaggacgagatggacggggtcctcaacgggagcccctcct
ggcacgcggccaccagccacatagtgaatggagccaccgtgcaccagagcagcctcgaagtccatgagatccgtcgagca
gccgatgtgaggcaggcgctgagagaggcaggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcacttc
ccagctccacatcactcccagcacagcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgttaaggagatgagggtattggtg
aaacgcatcgtgtcttggatgaccacgtacttgaccgaccacttagatccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacgatgctgctgccgagatgagaaaaggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|G3SPN0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Loxodonta africana GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagttggagtcagtt
tagtgatgtggaggagaataggactggggcctcggaaggcactgaatccgagatggagatccccagtgccatcaatggca
acccatcccggcacctggcagacagccctgcggtgaatggagctactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcagtgaagcaagctctgagggaggcaggcgatgagttcgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggctacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggtaaggaccacgccccttttgtgcttcagtacctcagtgaaggaagacatagcctatgtgttcattcaggtcaaaa
cctatgcaagtgggaagttagtccagtgtttcctcaccctgacacaatggttcaccacccaa
>gnl|bcl2dbcds|A0A2K5VPG2_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5VPG2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|I7GKS6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L1 (length=447 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctggcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtc
gcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcgg
atcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgt
ggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatga
ctgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|Q2PFS6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L1 (length=570 residues).
atggagacccccagtgccatcaatggcaacccatcctggcacctggtggacagccccgcggtgaatggagccactggcca
cagcagcagtttggatgcccgggaggtgatccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttg
aactgcggtaccggcgggcgttcagtgacctgacatcccagctccacatcaccccagggacagcatatcagagctttgaa
caagtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtg
cgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacc
tagagccttggatccaggagaacggcggctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccga
aagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcag
tcggaaatga
>gnl|bcl2dbcds|F6UKR4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|F6UKR4_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5YR37_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5YR37_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5YR37_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L1 (length=513 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggacacttttgtggaactctatggga
acaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccggcgtg
gttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|G1N5N5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Meleagris gallopavo GN=BCL2L1 (length=690 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcgcagaaggggcactgctggagcgagct
ggaggaagaggatgagaacaggactgacactgcagcagaggcagagatggacagcgtcctcaatgggagcccatcctggc
acccgcctgccggccacgtagtgaatggagccgccgtgcacaggagcagcctggaagttcatgaaattgttcgagcatct
gacgtgaggcagacgctgagagatgcaggggatgagtttgagctgaggtaccggagggctttcagcgatctcacctccca
gctccacatcacccctggcacggcgtaccagagctttgagcaggtagtgaacgaactcttccatgatggtgtgaactggg
ggcgcatcgtggctttcttctccttcggaggggctttgtgcgtggagagcgtggacaaggagatgcgggtactggtggga
cgcattgtgtcttggatgaccacgtacttgaccgaccatctagacccctggatccaggagaatggcggctgggagcgctt
tgtggacctgtatgggaataatgctgctgccgagctgaggaagggccaggagaccttcaacaaatggctcctgaccgggg
cgaccgtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A1U7QU73_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mesocricetus auratus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctagtggttgactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaacaggactgaggccccagaaggagccgaatcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcacgggaggtg
atccccatggcagccgtgaagcaagcgctgagagaggccggcgatgagtttgaactgcggtaccggcgggcattcagtga
tctgacatcccagcttcatataaccccgggaactgcatatcaaagctttgagcaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggtggagccctctgtgtggaaagcgtagacaaggagatgcag
gtgttggtgagtcggattgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggacaacggcgg
ctgggacactttcgtggaactctatgggaacaatgcagcagctgagagccggaaaggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctctctcttcagtcggaagtga
>gnl|bcl2dbcds|F6WA14_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Monodelphis domestica GN=BCL2L1 (length=684 residues).
atgtcgcacagtaaccgggagctggtgattgactttctttcttacaagctctcacagaaaggatacaattggagtcagtt
tgaagatgagaacaggactgaggttctagaaggggcagagatacctagtactgtgaatggcagtccctcttggcaccctg
ctgacagccgtgctgtgagtggggccacagggcacagcagcagcctggatgcccatgagacaataccagtggctgctgtg
aagcaagctttgagggaggcaggagatgaatttgaacttcggtacaggcgggcattcagtgacctgacatcccagctcca
catcacgccaggaacagcttatcagagctttgagcaggtagtgaatgaactcttccgggatggggtgaactggggccgaa
ttgtggcattcttctccttcggaggggcattgtgtgtggaaagcgtggataaggagatggaagtcttggtaggacgcatc
acctcctggatggccacttacttggatgaccacctagacccttggatccaagaaaatggcggctgggacacctttgtgga
actttatgggaatgatgcagctgcagagagccggaagggccaggaacgcttcaaccgatggctgctgactggcatgacag
tggccggtgtagtcctgctggggtccctattcagccggaagtga
>gnl|bcl2dbcds|O35843_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mus musculus GN=BCL2L1 (length=708 residues).
atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgttgaagagaataggactgaggccccagaagaaactgaagcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagcccggccgtgaatggagccactggccacagcagcagtttggatgcgcgggaggtg
attcccatggcagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcggtaccggagagcgttcagtga
tctaacatcccagcttcacataaccccagggaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctatctgaatgaccacctagagccttggatccaggagaacggcgg
ctggggtgtgagtggaggtacacccctcagatctgtcttcagaaggcttgttcaagtgccaggagtggcggagcacgttt
gtgatcccagcctttgggaggtggaaacagaaggatcggaagttcaaggccctcctcagctattatag
>gnl|bcl2dbcds|Q64373_BCL2L1-09 BCL2-like 1 gene OS=[Eukaryota] Mus musculus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaataggactgaggccccagaagaaactgaagcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagcccggccgtgaatggagccactggccacagcagcagtttggatgcgcgggaggtg
attcccatggcagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcggtaccggagagcgttcagtga
tctaacatcccagcttcacataaccccagggaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggatctctacgggaacaatgcagcagccgagagccggaaaggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcactcttcagtcggaagtga
>gnl|bcl2dbcds|Q64373_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Mus musculus GN=BCL2L1 (length=630 residues).
atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaataggactgaggccccagaagaaactgaagcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagcccggccgtgaatggagccactggccacagcagcagtttggatgcgcgggaggtg
attcccatggcagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcggtaccggagagcgttcagtga
tctaacatcccagcttcacataaccccagggaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggtaagaaccacgccccttgtgtgtccgccccttgcttgtgtctctcttctctgtgaacatccctaa
>gnl|bcl2dbcds|Q64373_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mus musculus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaataggactgaggccccagaagaaactgaagcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagcccggccgtgaatggagccactggccacagcagcagtttggatgcgcgggaggtg
attcccatggcagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcggtaccggagagcgttcagtga
tctaacatcccagcttcacataaccccagggaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggatctctacgggaacaatgcagcagccgagagccggaaaggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcactcttcagtcggaagtga
>gnl|bcl2dbcds|Q64373_BCL2L1-04 BCL2-like 1 gene OS=[Eukaryota] Mus musculus GN=BCL2L1 (length=630 residues).
atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaataggactgaggccccagaagaaactgaagcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagcccggccgtgaatggagccactggccacagcagcagtttggatgcgcgggaggtg
attcccatggcagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcggtaccggagagcgttcagtga
tctaacatcccagcttcacataaccccagggaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggtaagaaccacgccccttgtgtgtccgccccttgcttgtgtctctcttctctgtgaacatccctaa
>gnl|bcl2dbcds|M3Z2H9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mustela putorius furo GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgcagaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtaaagcaagcgctgagggaggctggggatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatctcagcttcacatcaccccagggacagcgtatcagagctttgagcaggtggtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggctctgtgtgtggagagcgtagacaaggagatgcag
gcattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggacactttcgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|G1P9D2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Myotis lucifugus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggaactggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccctgcggtgaatggagccactggccacagcagtagcttggatgcccgggaggtg
attcccatggcagcggtgaagcaagcgctgagggaggcaggcgacgagtttgaactgaggtaccggcgggcgttcagcga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgagcaagtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctcgttcggtggggcattgtgcgtggaaagtgtggacaaggagatgcag
gtattggtgagtcggattgcaacgtggatggccacttacctgaatgaccacctagagccttggatccaggagaacggagg
ctgggacacttttgtggaactctacgggaacaacgcagcagccgagagccggaagggccaggaacgcttcaatcgctggt
tcctgacgggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|R4JQR8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mytilus galloprovincialis GN=BCL2L1 (length=558 residues).
atgaaccagtttagttcaagatatttagtggcagactttattaatgaccgacttcgaaaacatggaatgcgatgggacaa
ctgtcctacgttagacttgccaccatcacaaattcagcttaaattacgttcacttggagatgaattccaagaaagatttc
agactcagtttgacgatatggtcaatcagttacacataactgaggctactgcatatccaacgtttcaaagagttgttcag
gaattatttattgatggaaatattaactggggaaggattgtggctcttttcggttttggtgggtctttgtcagtgaaatg
tgtacaaagaggaatgccacaacttgtggattcaattgttgactgggtatctacctatttgtgtaatagtttagagcaat
ggattacagataacggtggttggcaaggatttgtggaagcctataaccaaggacagaatcataatgacagtccgtgggat
gtgaaaggacttgttaaatacggagcaataggtgtaataggcgcaatggcgttaagtgcttttctacatagaacgtga
>gnl|bcl2dbcds|G1RER8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L1 (length=651 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggc
>gnl|bcl2dbcds|C3VIT1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Odontesthes bonariensis GN=BCL2L1 (length=708 residues).
atgtctcaaaacagagaactggtggttttctacataaagtataaactctcccagagaaactatcctctcaaccacatagt
gctcaatgagcctccgaacaggactggtgccggggacgggggtctgggcgaggagcagagcacagagacgcacgccaacg
ggacttttaccgggaccagtcccgggaccccgccggtgtcccctctgaggcagcaaccgttgccgtcgacgacgacgacg
acgcgcctggacgcggtgaaagaggccctccgagacacggccaacgagttcgagctgcggtacgcccgcgccttcagcga
cctccacagccagctgcacatcacgccggccacggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacg
gcgtcaactggggtcgcatcgtggggcttttcgctttcggcggggcgctgtgcgtggagtgcgtggagagggagatgagc
cccttggtgggcaggatcgtggagtggatgacggtctacctggacaaccacattcagccctggatccagagccagggagg
atgggaacgcttcgctgagatcttcgggcaggacgcggcggccgaaagcaggaggtctcaggagagcttcaagaagtggc
tgctggtggggatgaccgtggtgaccggggtggtggtgggctcgctgttcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A286MU87_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus mykiss GN=BCL2L1 (length=651 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctatagactgtcccagaggaattattcatgttgtcaatt
ggggctggagggtgcaagtggacggactgacggagatgaggccattgcaaatgggtctgtggggaactaccggaacagca
gaagcaatttggcgaagccctcatctccacaggggggcatggagccagtgaaagcagcactacgggactcagtggatgag
tttgagctacgctacacccgtgccttcagtgacctctcctcccagctccacatcacccctgccacagcctaccacagctt
tgagagtgtgatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggtctgtttgctttcggcggggcct
tgtgtgttgagtgtgttgagaaggatatgagcccgctggtggcgcgcatcgcagattggatgaccacctatctggacaac
catatccagccctggatccagagccaaggcggatgggcagagatctttggcagagatgctgctgcagacgttcgacggtc
tcaggagagcataattaaatggctgctagttggggtgattctgctttcaggagtgctggtcggcactctcatcatgaaga
aacgccagtga
>gnl|bcl2dbcds|I3IZK7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oreochromis niloticus GN=BCL2L1 (length=705 residues).
tacaaaatgtctcaaaacagagaactggtgcttttctacataaggtataaactctcccagagaaactatcctctcaacca
catagtactcaacgagcctttgaacaggactgatgggggggcggcggggttggatgaggaacagcgaatagacacacacg
ccaatgggacttttaatggcacgagtcccgggacccctccggcatccccgcagcggcagcagcagccgccatcaacgacg
gacctcgacgcagtgaaggaggcgctccgggacacggccaatgagttcgagctgcgatacgctcgtgccttcagcgacct
tcacagccagctgcacatcacgccggccacggcctaccaaagctttgagaacgtgatggacgaggtgttccgggacggcg
tcaactggggccgcatcgtagggctttttgcgttcggcggggcactgtgtgttgagtgcgtcgagaaggagatgagcccc
ttggtgggcaggatcgtagagtggatgaccgtctacctagacaaccacattcagccctggatccagagccaaggaggatg
ggagcgcttcgctgaaatcttcgggcaggatgcggcggctgaaagccggaggtctcaggagagtttcaagaagtggctgc
tggtggggatgacggtggtgacgggcgttgtggctggtgctcttatcgcgcaaaaacgcctgtga
>gnl|bcl2dbcds|Q9MYW4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcgcagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccggaagggactggaccagagatggagacccccagtgccatcaatggca
acccagcctggcacccggcggacagccccgcggtgaacggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatgacagcagtgaagcaggctctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagcga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaagtagtgaacgaactcttccgggatg
gggtgaactggggccgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtggacaaggagatggag
gtattggtgagtcggatcgcggcgtggatggccacttacctgaatgaccacctggagccctggatccaggagaacggcgg
ctgggacacgtttgtggaactctacggcaacaacgcagcagccgagagccgcaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgaccgtggctggcgtggttctgctgggctccctcttcagccggaaatga
>gnl|bcl2dbcds|C1BLI0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Osmerus mordax GN=BCL2L1 (length=669 residues).
atgtcttacagtaaccgtgagctggtggtgttcttcataagctataaactttcacagaggaattatcctatttctcagtt
gggactggaagatgccagtgaacggactaatgttgacaagaccaatgtctccccagttaatggatctgttgaaaatgacc
gaaattgcataggcagtctggggatatcttcatctccacaggggggtatagaggcggttaaagcagctcttagagactct
gcagatgagtttgaattgcgttacaccagagccttcaatgatccctcttctcaactgcatatcacccctgctacagcata
ccatagctttgaaagtgtaatgaacgaggtgttcagggacggcgtcaactggggacgtgtagtaggcctgtttgcttttg
gtggtgctctttgtgctgagtgtgtcgagaaggatatgagtcacctggtagcgcgtattgcagattggatgaccacctac
ctggacaaccacatccagccatggatacagagacagggtggatgggaccgatttgctgacattttcggcagggatgctgc
tgctgaggttcgacgttcccaggagaacctaagaagatggctgctagtaggggcgatactgcttgcaggagtgttggtcg
gctctctcattgcaaagaaacatcattga
>gnl|bcl2dbcds|H0X6V2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Otolemur garnettii GN=BCL2L1 (length=699 residues).
atgtctcagagcaaccgggagctggtggttgactttatctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagaacaggactgaggccccagaagggaatgaatcagagctggagacccccagtgccattaatggca
acccatcctggcacctggctgacagccccacggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcactgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatctcagctgcacatcaccccagggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgaattgtggcctttttctccttcggcggggctctgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacttgaatgaccacctagagccttggatccaggagaacggcgg
ctggtggaggtgtcaggcctttccagagcttctctctcccaaatcaaattccatttatttcaaagtttgcatgtgtggca
atttttgctctttggctgcagctgggagatgcttgactataggagttatgggttattct
>gnl|bcl2dbcds|Q9MZS7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ovis aries GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggacagaatcagatatggaaacccccagtgccatcaatggca
acccatcttggcacctggcggatagccctgcggtgaatggagccaccggccacagcagaagcttggatgcccgggaagtg
atccccatggcagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacgtcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggctacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacgtttgtggaactctacgggaacaacgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|W5PSA5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ovis aries GN=BCL2L1 (length=699 residues).
atgtctcagagcaaccgggaactagtggttgactttctctcttacaagttttttcagaaaggatacagctggagtcagtt
tagtgacatggaagagaacagaactgagaccctagaagggacagaatcagatatggaaacccccagtgccatcagtggca
acccatcctggcacctggcagatagccctgtggtgaatggagccactggtcacagcagaagcttggacaccgggaaaatg
atccccatggcagtggtgaagcaagccctgagggaggcaagcaatgagtgtgaattgaggtaccaacagacattcagcga
cctgacgtcccagctccacatcaccccagggaaagcatatcagagctttgaacaggtaataaatgaactcttccaggatg
gggtgaactggggtcgcaatgtggcctttttctccttcggtggggcactatgcatgaaaagcatagtcaaggagatgcag
gtattggtaagtcaggtcacgacttggatggccacttacctaaatgaccacctagagccttggatccaggagaatggcga
ctgggacatttttgtggaactctacgaaaacaatacagcaaccgagagccaaaagggccaagagcacctcaaccgctggt
ccctgacggacatgactgtggccggtatggctctgctgggcttgctcttcaactgtaag
>gnl|bcl2dbcds|K7F655_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Pelodiscus sinensis GN=BCL2L1 (length=690 residues).
atgtcgaacactaacagggaattagtgattgacttcctctcctacaagctatcgcagaggggacacagctggagctggtt
cgagggggaggatgagatcaggactgaggctgcagaagaggcggagatggcaagcgtccctaatgggagtccatcctggc
atccaggtgccagccacgtagtgaacggggctgccgggcacagtaacagccttgaagcccatgaaagggttccggcagcc
gaagtgaggcaggcgctgagagaggcaggagatgagtttgaattgaggtatcggagggctttcagtgacctcacttccca
gctccacatcaccctgggcacggcttaccagagcttcgagcaggtggtgaatgaactcttccgggacggagtgaactggg
ggcgcattgtggcttttttctcctttggaggagccctgtgcgtggagagtgtggacaaggagatgcaggtgttggtggga
cgcatcgcctcttggatgaccacttacctgactgaccaccttgatccctggatccaagagaatggcggttgggagcgctt
tgtggatctctacgggaacgatgctgctgccaagagcaggaaaggccaggagcagttcaacagggggctgctgacggggg
cgactgtggccggcgtgctcctcctgggctcgctgctgagccgcaagtag
>gnl|bcl2dbcds|A0A087X9B7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Poecilia formosa GN=BCL2L1 (length=696 residues).
atgtcacgaaacagagaactggtgcttttctacattaagtttaaactgtctcagaggaactatccgatccaacacatatt
gcccaatgagcccccggacagcaccgctgctggggacgcggccggggacgcggggatggacgacgagcagacgttggaga
cgcacgctaatgggacttttaacgggacaagtccaggatccccgaggcggcaacaggcggcgtcggcggcaacgatggac
gcggtgaaagtgaccctgcgagacacggcccgtgagttcgagctgcgctactcccgcgccttcaacgaccttcacagcac
gctgcacatcacaccggccaccgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactggg
gccgcatcgtggggctcttcgcgtttggtggcgcgctctgcgtggaatgcgttgagaaggagatgagccacctggtagcc
aggattgtagagtggatgaccgtctacttggatgagcggattgaaccttgggtggagagccaaggaggatgggaccgttt
cgctgagatcttcgggggcaacgcggcggcagagagcagaagatctcaggagagcttcaaaaactggctgctgctgggga
tgagtgtggtgacggccttcatagccgggtccatcttcgcccagaagcgcctgtga
>gnl|bcl2dbcds|A0A087YBW4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Poecilia formosa GN=BCL2L1 (length=660 residues).
atgtcctacagcaacagagaactggtggagttctacataagctacaaattgtctcagagaaactattcaagctctctgct
gaggtccgaggccgacggggccaggaccaattgggatggggacagccggggccctagcaatggtccgctggtcaacagct
gggccggctccccagggaagtcccgggaccctcccaccggcgtcaaggttgtcaaattggttctgaaggacgcggcagag
gagtttgaacgcctctacacccaaagctttaaacacctttccttgcagctggacatcacccccgacacggcctaccagag
cttcaagaccgtgctggatgagttgttcaagggtgaggtcaactggggtcgggtggtggccatgtttacctttgggggaa
ttctgtgtgtggattgcgttcagaagaatatgagtgagctggtctcccgcattgccgaatggatgaccacttacctggac
gagcagctcaatccctggatccaaagccagggaggatgggaccgcttcgctaacctgtacggccaggatgccgctgcaga
gggccggaggtttcgggagaccttgaacaaatggctgctagtcggtgtggctctgctgaccggagctctgctcgtcatgt
tcgtcgctaagaaacgatga
>gnl|bcl2dbcds|A0A2J8VIH3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Pongo abelii GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagctgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K6G3C5_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Propithecus coquereli GN=BCL2L1 (length=438 residues).
atgcagaagagaacaggactgaggccccagaagcgactgaatcggagatggagacccccagtgccattaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgagatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggccctctgcgtcgaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcaact
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
cggaaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgctggttcctgacgggcatgactgtggctg
gcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K6G3C5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Propithecus coquereli GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tatcgatgcagaagagaacaggactgaggccccagaagcgactgaatcggagatggagacccccagtgccattaatggca
acccatcctggcacctggcggacagccccccagcgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcactgaaggaggcgggcgatgaatttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccctagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgagatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggccctctgcgtcgaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacggaaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|P53563_BCL2L1-04 BCL2-like 1 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2L1 (length=699 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
tagcgatgtcgaagagaacaggactgaagccccagaagaaactgaaccagaaagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagccccgcggtgaatggagccactggccacagcagcagtttggatgcgcgggaggta
atccccatggcagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcggtaccggagagcattcagtga
tctaacatcccagcttcatataaccccagggacagcatatcagagctttgaacaggtagtgaatgaactctttcgggatg
gggtaaactggggtcgcattgtggccttcttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggtaagaaccacgccccttgtgtgtccgccccttgtgtgtctctcctctgtggagatccctaactgccctttttggt
ctcctggcatggttgttgaagatatcgattattcaggagacattcctggctcactttaa
>gnl|bcl2dbcds|P53563_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
tagcgatgtcgaagagaacaggactgaagccccagaagaaactgaaccagaaagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagccccgcggtgaatggagccactggccacagcagcagtttggatgcgcgggaggta
atccccatggcagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcggtaccggagagcattcagtga
tctaacatcccagcttcatataaccccagggacagcatatcagagctttgaacaggtagtgaatgaactctttcgggatg
gggtaaactggggtcgcattgtggccttcttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggatctctacgggaacaatgcagcagccgagagccggaaaggccaggagcgtttcaaccgctggt
tcctgacgggcatgactgtggctggtgtagttctgctgggctcactcttcagtcggaagtga
>gnl|bcl2dbcds|P53563_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2L1 (length=855 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
tagcgatgtcgaagagaacaggactgaagccccagaagaaactgaaccagaaagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagccccgcggtgaatggagccactggccacagcagcagtttggatgcgcgggaggta
atccccatggcagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcggtaccggagagcattcagtga
tctaacatcccagcttcatataaccccagggacagcatatcagagctttgaacaggtagtgaatgaactctttcgggatg
gggtaaactggggtcgcattgtggccttcttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggtaagaaccacgccccttgtgtgtccgccccttgtgtgtctctcctctgtggagatccctaactgccctttttggt
ctcctggcatggttgttgaagatatcgattattcaggagacattcctggcttcactttaataccaggggttaactttggg
aatattgatgaccctgtttttaaggaacctgtatttttcattctggctacccttgtggccccgcagtttcatagttttgt
tccaatttctcggcaaagaaaaacagcctgtgtgtttacttggcttaaaacctag
>gnl|bcl2dbcds|P53563_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2L1 (length=855 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
tagcgatgtcgaagagaacaggactgaagccccagaagaaactgaaccagaaagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagccccgcggtgaatggagccactggccacagcagcagtttggatgcgcgggaggta
atccccatggcagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcggtaccggagagcattcagtga
tctaacatcccagcttcatataaccccagggacagcatatcagagctttgaacaggtagtgaatgaactctttcgggatg
gggtaaactggggtcgcattgtggccttcttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggtaagaaccacgccccttgtgtgtccgccccttgtgtgtctctcctctgtggagatccctaactgccctttttggt
ctcctggcatggttgttgaagatatcgattattcaggagacattcctggcttcactttaataccaggggttaactttggg
aatattgatgaccctgtttttaaggaacctgtatttttcattctggctacccttgtggccccgcagtttcatagttttgt
tccaatttctcggcaaagaaaaacagcctgtgtgtttacttggcttaaaacctag
>gnl|bcl2dbcds|A0A2K6LPM4_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Rhinopithecus bieti GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttatctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K6LPM4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Rhinopithecus bieti GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K6QFA2_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K6QFA2_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttatctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K6QFA2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K6UWY8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccagcctggcacctggcggacagccccgcggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcaataaagcaagcactgagggaggcaggcgacgagtttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcgtatcaaagctttgaacaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaa
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcagcagccgagagcagaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|A0A2K6UWY8_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L1 (length=441 residues).
atgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatgctccacat
cacccccgggacagcgtatcaaagctttgaacaggtagtgaacgaactcttccgggatggggtgaactggggtcgcattg
tggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaagtattggtgagtcggatcgca
gcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaact
ctatggaaacaatgcagcagccgagagcagaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtgg
ccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|E2IV77_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Saimiri boliviensis GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccagcctggcacctggcggacagccccgcggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcaataaagcaagcactgagggaggcaggcgacgagtttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcgtatcaaagctttgaacaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaa
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcagcagccgagagcagaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|B5XAY3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Salmo salar GN=BCL2L1 (length=687 residues).
atgatgacttacaacaacagagaactggtggtgtactatattacctataaactatcacagagggactaccccttcaacca
catggagctcacggaagcccagaatcggactgaggtgggacaggtggaagggggtgcggcagtcctaacatacgtcaacg
ggacgagtcccgggactccaccaccacggcagtcgcccccctcctcccctcggcggacagcgggcctggacgcagtgaaa
gaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagcgttcagtgacctgtcctcccagctacacat
cacgccgtccacagcctaccagagctttgagaacgtgatggacgaggtgttccgggacggtgtcaactggggacgggtgg
tgggcctgttttccttcggaggggccctctgtgtagaatgtgtggacaaggagatgaaccccttggtgggaaggatcaca
gactggatgaccgtctacctggacaaccacatccagccctggatccagagccaaggaggatgggaccggtttgcagagat
ctttggaatggacgctgcagccgagagcaggaagtctcaggagagctttaagaagtggcttctggcagggatgaccctgg
tcacaggagtcgtcgtagggtcactcttcgctcagaaacgcctgtga
>gnl|bcl2dbcds|C0HAD8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Salmo salar GN=BCL2L1 (length=651 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctatagactgtcccagaggaattattcatgttgtcaatt
ggggctggagggtgcaagtggacggactgagggagatgacgccattgcaaatgggtctgtggggaacagcagaagcaatt
tggcgaagccctcatctccacaggggggcatggagccagtgaaagcagcactacgggactcagtggatgagtttgagctg
cgctacacccgcgccttcagtgacctctcctcccagctccacatcacccctgccacagcctaccacagctttgagagtgt
gatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggtctgtttgctttcggcggggccttgtgtgttg
agtgtgttgagaaggatatgagcccactggtggcgcgcatcgcagactggatgaccacctacctggacaaccatatccag
ccctggatccagagccaaggaggatgggaccgttttgcagagatctttggcagagatgctgctgcagacgttcgacggtc
tcaggagagcataattaaatggctgctagttggggtgattctgctttcaggagtgctggtcggcactctcatcatgaaga
aacgccagtga
>gnl|bcl2dbcds|G3WKX6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sarcophilus harrisii GN=BCL2L1 (length=684 residues).
atgtctcacagtaaccgggagctggtggttgactttctttcttacaagctttcacagaagggatacaattggagtcagtt
tgaagatgagaacaggactgaggcctcagaagggacagagatacctagtactgtgaatggcagcccctcttggcaccctg
ctgacagccgtgcagtgagtggggccacaggacacagcagcagcctggatgcccatgagacaattcctgtagctgctgtg
aagcaagctttgagggaggcaggagatgaatttgaactccggtaccggcgggcattcagtgatctgacatcccagctcca
catcactccagggacggcttatcagagttttgagcaggtagtgaatgaactcttccgggatggggtgaactggggccgaa
ttgtggcattcttctccttcggaggggcattgtgtgtggaaagcgtggataaagagatggaagtcttggtagcacgcatc
acctcctggatggccacttacttggatgagcacctagacccatggatccaagaaaatggcggttgggacaccttcgtgga
gctttatgggaatgatgcagcagcagagagccggaagggccaggaacgcttcaacagatggctgctgactggcatgacag
tggctggtgtagtcctgctggggtccctgttcagccggaagtga
>gnl|bcl2dbcds|A0A2U9BY16_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Scophthalmus maximus GN=BCL2L1 (length=699 residues).
atgtctcagaacaaagaactggtggttttctacatacagtataaactctcccagaggaaatatcctctcaaccatatggg
acttaatgagcctccgaacaggactgatcggggggaggcaggtttgggggaggaacagcagacagcgccgcatgccaacg
gaactctaaacggcgtgaatcccgggacccccccagagtccccactgcggctgcaacggttgccttcatcgccgagcctg
gatgcagtaaaagaggcccttcgggactcggccaacgagtttgagctgcggtacgcgcgcgccttcagcgatctgcacaa
ccagctgcacatcacgccggccacggcctaccaaagcttcgagagtgtgatgaacgaggtgttccgggacggcgtcaact
ggggccgcatcatagggctttttgcatttggcggggcgctgagtgtggagtgtgtggagaaggagatgagttcgctggtg
ggcaggatcgttgagtggatgacggtgtacctagacaacaacatccagccctggatccaaagtcaaggaggatgggagca
ctttgctgaaatcttcgggcaggacgcggcggcagggagtcgaaggtctcaggagagtttcaagaagtggctgctggcag
ggatgaccctggtgaccggggtcgtggtgggctcactgattgcccagaagcgcctgtga
>gnl|bcl2dbcds|A0A0B4KJI5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sparus aurata GN=BCL2L1 (length=648 residues).
atgtcgtacagtaacagagagctagtggagtcctttttaagctacaaactgtctcagaggaactatccaactgccctgct
gaggccagatgatgctggtggaaggactgaggcagacaaagccaactcagctgccacaaatggcctgctggccaacagca
gcaacgggggcggacagccaggtgctgacatagaggctgttaaagcagctcttcgggactcatctgaagagtttgaactg
ctcttcacacaagcgtttagtgacctctccacgcagctcgacatcactcctgacacagcctaccacagctttaagagcgt
gatggacgaggtgttcaaggacggagtcaactggggacgtgtagtgggcctgtttgcttttggcggtgtgctgtgtgtgg
aatgcgttgagaaggatacgagcgagctggtctcccgcatcgcagactggatgaccatgtacctggatgagcacatcaat
ccgtggattgagagccaaggaggatgggactcctttgctgaggtttttgggcgagacgcagctgcagaagcgaggagatc
tcgggagactctgagtcggtggctgctggttggagtggcgctgctaatgggagttgtgctcggtgtcctcatcgctaaga
aacagtga
>gnl|bcl2dbcds|O77737_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sus scrofa GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tactgatgtggaagagaacagaactgaggccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgaggtaccggagggcattcagtga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagctttgagcaggtattgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacggaaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgatggt
tcctgacgggcatgactctagctggggtggttctgctgggttcgctcttcagtcggaaatga
>gnl|bcl2dbcds|H0Z8G3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Taeniopygia guttata GN=BCL2L1 (length=687 residues).
atgtacagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagaaaggatacagctggagtcagct
ggaagaggaggatgagaacaggactgactttgcaggggaggaggacgagatggacggggtcctcaacgggagcccctcct
ggcacgcggccaccagccacatagtgaatggagccaccgtgcaccagaacagcctcgaagtccatgagatccgtcgagca
gctgatgtgaggcaggcgctgagagaggcgggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcacttc
ccagctccacatcactcccagcacagcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgttaaggagatgagggtattggtg
aaacgcatcgtctcttggatgaccacgtacttgaccgaccacttagatccctggatccaggagaatggcggatgggagcg
ctttgtggactctatgaacgatgctgctgccgagatgagaaaaggccaggagttcaacaaatggctcctgacgggggcga
cggtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A0F7L1T6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Takifugu obscurus GN=BCL2L1 (length=657 residues).
atgtcgtataacaacagagagctggtggagcacttcttaagatacaagctgtctcagaggaactacccatcttctctgct
gagaccagaggatactgatggaaggacagagggagaaaagaggagccccgctgcttccaatggcctgctggtccgcagca
ggaacaggggtggagcgtctccatccgcaggtgctggcattgaggctgtgaacgcagctcttcgggactcggcagaagag
tttgagaagctctttgctcaagcattcagcgacctctcctcacagctcgacatcactcctgacacggcttaccagagctt
taagaatgtgatggacgaggtgttcaaggacggagacaactggggacgagttgtgggactatttgcctttggcggggtac
tatgtgtggaatgtgtcgagagggatgcgagccaactggtttgccgcattgcagactggatgaccatttacctggatgag
catattaacccgtggatccagagtcaaggaggatgggattgcttcgcgaagatttttggggacgacgccgcggcagaggg
gaggagagctcgcgagaacctgagtagatggatgctgggcggattggcgctgctgatgggagttttggtcggcgctttca
tcgtcaagaaacattga
>gnl|bcl2dbcds|H2SNZ8_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Takifugu rubripes GN=BCL2L1 (length=657 residues).
atgtctcaaaacagagaactggtcattttctatattaagtacaaactctcccaaagaaattaccctttcaatcacaatgg
actcatattagagcctccaagtaggactgatgggcagtttgtaactactcagttcaatggaacttttaatggtgcaagcc
ctggaacacccccagcaacaagtctggcaacaagtctggatacagtaaaggaagccctccgggacacaggcaatgaattt
gagctgcgatacacttgtgctttcagtgacctgcacaaccagctacacatcaccccagctactgcttaccaaagttttga
gaatgttatggatgaggtatttagggatggagtcaactgggggcggatagtggggctttttgcatttggtggtgctctct
gtgtggagtgtgttgagaaggagatgagtcccctggtgggccggattatagagtggatgacagtctatcttgacaaccac
attcaaccatggatccagagtcaaggaggatgggtccgttttgctgaactctttgggcaggatgcagcagcagaaagcag
gagatctcaggagagattcagaaacggactcctggtggggatgagcctggcagcagggatcgcaatcgggtcgttcatag
tgaggaaactcctgtga
>gnl|bcl2dbcds|H2SNZ8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Takifugu rubripes GN=BCL2L1 (length=657 residues).
atgtctcaaaacagagaactggtcattttctatattaagtacaaactctcccaaagaaattaccctttcaatcacaatgg
actcatattagagcctccaagtaggactgatgggcagtttgtaactactcagttcaatggaacttttaatggtgcaagcc
ctggaacacccccagcaacaagtctggcaacaagtctggatacagtaaaggaagccctccgggacacaggcaatgaattt
gagctgcgatacacttgtgctttcagtgacctgcacaaccagctacacatcaccccagctactgcttaccaaagttttga
gaatgttatggatgaggtatttagggatggagtcaactgggggcggatagtggggctttttgcatttggtggtgctctct
gtgtggagtgtgttgagaaggagatgagtcccctggtgggccggattatagagtggatgacagtctatcttgacaaccac
attcaaccatggatccagagtcaaggaggatgggtccgttttgctgaactctttgggcaggatgcagcagcagaaagcag
gagatctcaggagagattcagaaacggactcctggtggggatgagcctggcagcagggatcgcaatcgggtcgttcatag
tgaggaaactcctgtga
>gnl|bcl2dbcds|H2U5I3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Takifugu rubripes GN=BCL2L1 (length=657 residues).
atgtcgtataacaacagagagctggtggagcacttcttaagatacaagctgtctcagaggaactacccaacttctctgct
gagaccagaggatactgatggaaggacagagggagaaaagaggagccccggtgcttccaatggcctgctggtccgcagca
ggaacaggggtggagcgtctccatccgcaggtgctggcatagaggctgtgaacgcagctcttcgggactcggcagaagag
tttgagaagctctttgctcaagcattcagcgacctctcctcacagctcgacatcactcctgacacagcttaccagagctt
taagaatgtgatggacgaggtgttcaaggacggagtcaactggggacgagttgtgggactatttgcctttggcggggtac
tatgtgtggaatgtgtcgagaaggatgcgagccaactggtttgccgcattgcagactggatgaccatttacctggatgag
catattaacccgtggatccagagtcaaggaggatgggattgcttcgcgaagatttttggggacgacgccgcggcagaggg
gaggagagctcgcgagaacctgagtagatggatgctgggcggattggcgctgctgatgggagttttggtcggcgctttca
tcgtcaagaaacattga
>gnl|bcl2dbcds|H2U5I3_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Takifugu rubripes GN=BCL2L1 (length=657 residues).
atgtcgtataacaacagagagctggtggagcacttcttaagatacaagctgtctcagaggaactacccaacttctctgct
gagaccagaggatactgatggaaggacagagggagaaaagaggagccccggtgcttccaatggcctgctggtccgcagca
ggaacaggggtggagcgtctccatccgcaggtgctggcatagaggctgtgaacgcagctcttcgggactcggcagaagag
tttgagaagctctttgctcaagcattcagcgacctctcctcacagctcgacatcactcctgacacagcttaccagagctt
taagaatgtgatggacgaggtgttcaaggacggagtcaactggggacgagttgtgggactatttgcctttggcggggtac
tatgtgtggaatgtgtcgagaaggatgcgagccaactggtttgccgcattgcagactggatgaccatttacctggatgag
catattaacccgtggatccagagtcaaggaggatgggattgcttcgcgaagatttttggggacgacgccgcggcagaggg
gaggagagctcgcgagaacctgagtagatggatgctgggcggattggcgctgctgatgggagttttggtcggcgctttca
tcgtcaagaaacattga
>gnl|bcl2dbcds|H3CH49_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Tetraodon nigroviridis GN=BCL2L1 (length=696 residues).
cgaagtcaccccggagcaaagtcaaaaggcgcatctacgcagaggatgtctctaaacagagaactggtcattttctacat
taaatacaaactttcccaaagaaactaccctttgagtcacattgtagagccttcaagtaggactgaagggcagtttggaa
ccacccagtccaatggaacttttaatggggcaagtcctggaacccccccagcaccctcccagcaccagcagtcattgaca
agtctggacgcagtcaaggaagccctccgggacaccggcaatgaatttgagctgcggtacacctgcgcgttcagtgacct
gcacaaccagctccacatcacgccagccacggcttaccaaagttttgagaacgttatggatgaggtgtttcgggatggag
tcaactgggggcggatagtgggcctttttgccttcggtggtgccctgtgtgtggagtgtgtggagaaggagatgaatcct
ctggttggccggatcatagagtggatgacggtctatctggacaaccacatccagccctggatccagagtcaaggaggatg
ggaacgttttgctgaactcttcgggcaggacgcggctgcagaaagccgcaggtcccaggagcgattccgaaacgggctgt
ttctgggcatgagtctggcggcagggatcgccctcggctccttcatcgtcatgagg
>gnl|bcl2dbcds|Q2TAP5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Xenopus laevis GN=BCL2L1 (length=615 residues).
atggagggcagcagtagagatctggtggagaagtttgttagtaagaaactttcccagaatgaagcctgcaggaagttctc
caataatccccaacccaatgccatatctaatggaacttctacttcagagcgccccggggaaggggccacgcagggcattg
tggaggaggaagtccttcaagcccttttggaagcaacggaggagtttgagttgagatatcagcgtgccttcagtgacctg
acctcacagctgcacatcacccaggacacggcccagcagagcttccagcaagttatgggagagttgttcagggatgggac
aaactgggggagaattgtggctttcttctcatttgggcgggccctatgtgtggagagtgcaaacaaggagatgactgatc
tgctacccagaattgtccagtggatggtgaattatctagagcacacactgcagccctggatgcaggagaatggaggctgg
gaagcttttgtcggcctgtatggaaagaatgccgcagcccagagcagagaaagccaggaacgatttggcaggttgctgac
tatagtgattctgactggtgttttcgcattggtctgctacatgaggcgccgatag
>gnl|bcl2dbcds|Q91828_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Xenopus laevis GN=BCL2L1 (length=615 residues).
atggagggcagcagtagagatctggtggagaagtttgttagtaagaaactttcccagaatgaagcctgcaggaagttctc
caataatcccaacccaatgccatatctaatggaaccttctacttcagagcgccccggggaaggggccacgcagggcattg
tggaggaggaagtccttcaagcccttttggaagcaacggaggagtttgagttgagatatcagcgtgccttcagtgacctg
acctcacagctgcacatcacccaggacacggcccagcagagcttccagcaagttatgggagagttgttcagggatgggac
aaactgggggagaattgtggctttcttctcatttgggcgggccctatgtgtggagagtgcaaacaaggagatgactgatc
tgctacccagaattgtccagtggatggtgaattatctagagcacacactgcagccctggatgcaggagaatggaggctgg
gaagcttttgtcggcctgtatggaaagaatgccgcagcccagagcagagaaagccaggaacgatttggcaggttgctgac
tatagtgatgctgactggtgttttcgcattggtctgctacatgaggcgccgatag
>gnl|bcl2dbcds|Q6GLI5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Xenopus tropicalis GN=BCL2L1 (length=606 residues).
atggagggcagcagtagagatctggtggagaagtttgtttgcaagaaactgtcccagaaaggagcctgcggggagttctc
cagcaactcccagcccaagggcgtgtctaatggaagttcggagggccccggggccacacagggcattgtgggggaggaag
tccttcaggcgctgctggacgcgtcggaggagtttgagttgagataccagcgtgccttcagcgacctgaccgcccagctg
cacctcacccaggacactgcccagcaaagcttccagcaggtggtgggggagttgttcagggacggcaccaactggggcag
aatcgtggccttcttctcctttgggcgggccctgtgcgtggagagtgccaacaaggagatgactgagctgctccccagga
tcgtgcaatggatggtgcagtacctggagcatacgctgcagccctggatgctggagaacggaggctgggaagcttttgtc
ggtctgtacggaaagggagctgccgcccagagcagggaagggccggagcggtttggccggtggctaatggccatagtgac
tgtgactgctgcaaccttattggtctcctacctgaggcgtcgatag
>gnl|bcl2dbcds|M4A558_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Xiphophorus maculatus GN=BCL2L1 (length=660 residues).
atggcctacagcaacagagaactggtggagttctacataagctacaaattgtctcagagaaactattcaagctctctgct
gaggtccgaggttgccgggggcaggaccaattgggaaggggacagccgggtccctagcaatggccggctggtcaacagcc
gggccgggcccccggggaagcccaggggcccaatggccggtgttgaggtcgtcaaatcagttctgaaggacgcggcggag
gagtttgagcgcctctacacccaaagctttaaacacctctccttgcagctggacatcacccccgacacggcctaccacag
cttcaagaccgtgctggacgagttgttcaagggcggggtcaactgggggcgggtggtggccatgtttaccttcgggggga
ttctgtgtgtggactgcgtccagaagaatatgagtgagctggtctcccgcattgccgaatggatgaccacttacctggat
gagcagctcagtccctggatccagagccagggaggatgggaccgctttgctaacctgtacggccaggacgccgctgcaga
gggccggaggtttcgggagaccttgaacaaatggctgctagttggtgtggctctgctgaccggagctctgctcgtcgtgt
tcgtcgctaagaaacgatga
© 1998-2018