Dataset for CDS BCL2L1 of organism all

[Download (right click)] [Alignment] [Repertoires]

215 sequence(s)

>gnl|bcl2dbcds|A0A3Q1EVP6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Acanthochromis polyacanthus GN=BCL2L1 (length=627 residues).
atgtcgtgcagtaacagagagctggtggagttctttataagctacaagctgtctcaaaggaactatccgatgtctctgct
gaggccagaggatgctggaggaaggactgatggggacaaggccagctcagcctccagtaacggcttgctggtgaacaaca
gagacggcatagaggctgtaaaatccacccttaaggatgcggcagatgaatttgaacttctcttcacgcaaactttcagt
gacctgtcttcgcagattgacatcacccctgaaacggcctaccacagctttaagagtgtgatggatgaggtgttcaagga
tggggtcaactggggacgtatagtgggcctgttttgctttggcggtgtactgtgtgtggaatgcgtagagaagaatatga
gtgagctggttccccgcatcgctgactggatgaccatgtacctggatgagcacatcagtccctggatccagagccaagga
gactgggagtgctttgctgagatttttgggcagaacgccgctgcagaagcacggaggtctcgggatactctgaagcgatg
gctgctagccggaggggtgctgctaatgggagtgctggctggtgtactcattgctaagaaacagtga
>gnl|bcl2dbcds|A0A3Q1FR00_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Acanthochromis polyacanthus GN=BCL2L1 (length=1107 residues).
atgttccgacggcacgtgaaggcgtcatattacgtaatagggaggcagggccgagcggacgtaggaggatacgtgcgagc
acacacactcgtgaacacaaagtggatgtgtgacattcttgtggagcttgacagctttttgtgcgcaccgagcgacagac
ggactggagacagcgtcacggagcggaggacagcttcccgggaatcccgtgcttttgtttcggttcttgctgggcctgag
ctggtttgtcagccttgtgtaggtttggttttcacccccgagcgtcctgtggatatcagcggaccatggtggtctgagca
gagggcagcaggaaggcagcctggcacagtgtgtgttcactctaacgcagcgagacggaccagagccacgaggacggaaa
acacattggcacgcaacatgtctcagaacagagaactggtggttttctacataaagtataaactgtcccagagaaactat
cccctcaaccacatggtgctgaacgaggctcccaacaggactgatgggggggaggcccggctgggagaggaccagcggac
agagacacacgccaacgggacttttaacggcacgagtcccgggacccccccgccgtccccgcggcggctggcgtcgacgg
cgaccatggacgcagtgaaggaggccctccgggacacggccaacgagttcgagctgcggtacgcccgcgccttcagcgac
ctgcacagccagctgcacatcacgcccgccaccgcctaccagagcttcgagaacgtcatggacgaggtgttccgggacgg
cgtcaactggggccgcatcgtggggctgttcgcgttcggcggggcgctgtgcgtcgagtgcgtggaaaaggagatgagcc
ccctggtgggcaggatcgtagagtggatgaccgtctacctggacaaccacattcaggactggatccagggccagggagga
tgggagcgttttgctgagatcttcggtcaggacgcggcggccgagagcaggaggtctcaggagagcttcaagaagtggct
gctggtggggatgacggtggtgacgggggtggtggtggggtcgctcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q1FR00_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Acanthochromis polyacanthus GN=BCL2L1 (length=690 residues).
atgtctcagaacagagaactggtggttttctacataaagtataaactgtcccagagaaactatcccctcaaccacatggt
gctgaacgaggctcccaacaggactgatgggggggaggcccggctgggagaggaccagcggacagagacacacgccaacg
ggacttttaacggcacgagtcccgggacccccccgccgtccccgcggcggctggcgtcgacggcgaccatggacgcagtg
aaggaggccctccgggacacggccaacgagttcgagctgcggtacgcccgcgccttcagcgacctgcacagccagctgca
catcacgcccgccaccgcctaccagagcttcgagaacgtcatggacgaggtgttccgggacggcgtcaactggggccgca
tcgtggggctgttcgcgttcggcggggcgctgtgcgtcgagtgcgtggaaaaggagatgagccccctggtgggcaggatc
gtagagtggatgaccgtctacctggacaaccacattcaggactggatccagggccagggaggatgggagcgttttgctga
gatcttcggtcaggacgcggcggccgagagcaggaggtctcaggagagcttcaagaagtggctgctggtggggatgacgg
tggtgacgggggtggtggtggggtcgctcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q0RTF8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Amphilophus citrinellus GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtgcttttctacataacgtataaactatcccagagaaactatcctctcaaccacatagt
actcaacgagccttcgaacaggactgatgggggggcagcagggttggatgaggaacagcgaatagatacacacgccaatg
ggacttttaatggcacaagtcccggtaccccgccagcgtccccgcagcggcagcaacagccgccatcaacaacgaacctc
gacgcagtgaaggaggcgctccgggacacagccaacgagttcgagctgcgatacgctcgtgccttcaacgatctgcacag
ccagctgcacatcacgccggccacggcctaccaaagcttcgagaatgtgatggacgaggtgttccgggatggcgtcaact
ggggccgcatcgtagggcttttcgcgttcggcggggcactgtgtgtcgagtgtgtcgagaaggagatgagccccctggtg
ggcaggatcgtagagtggatgacagtctacctagacaaccacattcagccctggatccagagccaaggaggatgggagcg
ctttgctgaaatctttgggcaggacgcggcggctgaaagccggaggtctcaggagagcttcaagaagtggctgcttgtgg
gcatgacggtggtgaccggcgtcgtggcaggtgcactcatcgcgcaaaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q1BQA0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Amphiprion ocellaris GN=BCL2L1 (length=627 residues).
atgtcgtacagtaacagagagctggtggagttctttgtaagcgacaagctgtctcaaaggaactatccgacgtctctgct
gaggccagaggatgctggaggaaggactgatggggacaaggccaactcagcttccagtaatggcttgctggtgaacagca
gaggtggcatagaggctgtaaaatccgcacttaaggacgcggcagatgagtttgaacttctcttcacgcaggcttttagt
gatctgtcttcacagcttgacatcacccctgaaacggcctaccacagctttaagagtgtgatggacgaggtgttcaagga
tggggtcaactggggacgtatagtgggcctgttttgctttggcggtgtactgtgtgtggaatgcgtagagaagaatatga
gtgagctggttccccgcatcgctgactggatgaccatgtacctggatgagcacatcagtccgtggatccaaagccaagga
ggatgggagtgctttgctgagatttttgggcagaacgccgctgcagaagcacgaaggtctcgggatactctgaagagatg
gctgctagtcggaggggtgctgctaatgggagttctggctggtgtgctcattgctaagaaacagtga
>gnl|bcl2dbcds|A0A3Q1DHJ3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Amphiprion ocellaris GN=BCL2L1 (length=690 residues).
atgtctcagaacagagaactggtggttttctacataaagtataaactctcccagagaaactatcccctcaaccacatggt
gctgaatgaggctcccagcaggactgacgggggggaggcccggctgggagaggaacagcggacagagacacacgccaacg
ggacttttaacggcacgagtcccgggacccccccgccgtccccgcggcggctggcgtcgacggcgaccatggacgcggtg
aaggaggccctccgggacacggccaacgagttcgagctgcggtacgcccgcgccttcagcgacctgcacagccagctgca
catcacgcccgccaccgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactggggccgca
tcgtggggctgttcgcgttcggcggggcgctgtgtgtcgagtgcgtggagaaggagatgagccccctggtgggcaggatc
gtagagtggatgaccgtctacctggacaaccacattcaggactggatccagagccaaggaggatgggagcgttttgctga
aatcttcggtcaggacgcggcggctgagagcaggaagtctcaggagagcttcaagaagtggctgctggtggggatgacgg
tggtgacgggggtggtggtgggatcactcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q1DHJ3_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Amphiprion ocellaris GN=BCL2L1 (length=690 residues).
atgtctcagaacagagaactggtggttttctacataaagtataaactctcccagagaaactatcccctcaaccacatggt
gctgaatgaggctcccagcaggactgacgggggggaggcccggctgggagaggaacagcggacagagacacacgccaacg
ggacttttaacggcacgagtcccgggacccccccgccgtccccgcggcggctggcgtcgacggcgaccatggacgcggtg
aaggaggccctccgggacacggccaacgagttcgagctgcggtacgcccgcgccttcagcgacctgcacagccagctgca
catcacgcccgccaccgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactggggccgca
tcgtggggctgttcgcgttcggcggggcgctgtgtgtcgagtgcgtggagaaggagatgagccccctggtgggcaggatc
gtagagtggatgaccgtctacctggacaaccacattcaggactggatccagagccaaggaggatgggagcgttttgctga
aatcttcggtcaggacgcggcggctgagagcaggaagtctcaggagagcttcaagaagtggctgctggtggggatgacgg
tggtgacgggggtggtggtgggatcactcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q1DHJ3_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Amphiprion ocellaris GN=BCL2L1 (length=690 residues).
atgtctcagaacagagaactggtggttttctacataaagtataaactctcccagagaaactatcccctcaaccacatggt
gctgaatgaggctcccagcaggactgacgggggggaggcccggctgggagaggaacagcggacagagacacacgccaacg
ggacttttaacggcacgagtcccgggacccccccgccgtccccgcggcggctggcgtcgacggcgaccatggacgcggtg
aaggaggccctccgggacacggccaacgagttcgagctgcggtacgcccgcgccttcagcgacctgcacagccagctgca
catcacgcccgccaccgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactggggccgca
tcgtggggctgttcgcgttcggcggggcgctgtgtgtcgagtgcgtggagaaggagatgagccccctggtgggcaggatc
gtagagtggatgaccgtctacctggacaaccacattcaggactggatccagagccaaggaggatgggagcgttttgctga
aatcttcggtcaggacgcggcggctgagagcaggaagtctcaggagagcttcaagaagtggctgctggtggggatgacgg
tggtgacgggggtggtggtgggatcactcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3P8TL99_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Amphiprion percula GN=BCL2L1 (length=690 residues).
atgtctcagaacagagaactggtggttttctacataaagtataaactctcccagagaaactatcccctcaaccacatggt
gctgaatgaggctcccagcaggactgacgggggggaggcccggctgggagaggaacagcggacagagacacacgccaacg
ggacttttaacggcacgagtcccgggacccccccgccgtccccgcggcggctggcgtcgacggcgaccatggacgcggtg
aaggaggccctccgggacacggccaacgagttcgagctgcggtacgcccgtgccttcagcgacctgcacagccagctgca
catcacgcccgccaccgcctaccagagcttcgagaacgtgatggatgaggtgttccgggacggcgtcaactggggccgca
tcgtggggctgttcgcgttcggcggggcgctgtgtgtcgagtgcgtggagaaggagatgagccccctggtgggcaggatc
gtagagtggatgaccgtctacctggacaaccacattcaggactggatccagagccaaggaggatgggagcgttttgctga
aatcttcggtcaggacgcggcggccgagagcaggaagtctcaggagagcttcaagaagtggctgctggtggggatgacgg
tggtgacgggggtggtggtgggatcactcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3P8TL99_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Amphiprion percula GN=BCL2L1 (length=690 residues).
atgtctcagaacagagaactggtggttttctacataaagtataaactctcccagagaaactatcccctcaaccacatggt
gctgaatgaggctcccagcaggactgacgggggggaggcccggctgggagaggaacagcggacagagacacacgccaacg
ggacttttaacggcacgagtcccgggacccccccgccgtccccgcggcggctggcgtcgacggcgaccatggacgcggtg
aaggaggccctccgggacacggccaacgagttcgagctgcggtacgcccgtgccttcagcgacctgcacagccagctgca
catcacgcccgccaccgcctaccagagcttcgagaacgtgatggatgaggtgttccgggacggcgtcaactggggccgca
tcgtggggctgttcgcgttcggcggggcgctgtgtgtcgagtgcgtggagaaggagatgagccccctggtgggcaggatc
gtagagtggatgaccgtctacctggacaaccacattcaggactggatccagagccaaggaggatgggagcgttttgctga
aatcttcggtcaggacgcggcggccgagagcaggaagtctcaggagagcttcaagaagtggctgctggtggggatgacgg
tggtgacgggggtggtggtgggatcactcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3P8U812_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Amphiprion percula GN=BCL2L1 (length=627 residues).
atgtcgtacagtaacagagagctggtggagttctttgtaagctacaagctgtctcaaaggaactatccgacgtctctgct
gaggccagaggatgctgaaggaaggactgatggggacaaggccaactcagcttccagtaacggcttgctggtgaacagca
gaggtggcatagaggctgtaaaatccgcacttaaggacgcggcagatgagtttgaacttctcttcacgcaggcttttagt
gatctgtcttcacagcttgacatcacccctgaaacagcctaccacagctttaagagtgtgatggacgaggtgttcaagga
tggggtcaactggggacgtatagtgggcctgttttgctttggcggtgtactgtgtgtggaatgcgtagataagaatatga
gtgagctggttccccgcatcgctgactggatgaccatgtacctggatgagcacatcagtccgtggatccaaagccaagga
ggatgggagtgctttgctgagatttttgggcagaacgccgctgcagaagcacgaaggtctcgggatactctgaagagatg
gctgctagtcggaggggtgctgctaatgggagttctggctggtgtgctcattgctaagaaacagtga
>gnl|bcl2dbcds|A0A3Q1GZ93_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Anabas testudineus GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtggttttctacataacatataaactatcccagagaaactatcctctcaaccacttggg
actcaatgagactcccaacaggactgatgggggggaagatgggttgagtgaggaacagcggatagcaacgcacgccaacg
ggacttttaatggtagaagtcccgggacccccccagcgtccccgctgcggcaacaacggttgccatcaacgacgagcctg
gatgcggtgaaagaggccctccgggactcggccaacgagtttgagttacgatacgctcgagccttcagcgatctgcacaa
ccagctgcatatcacgcctgccacagcctaccaaagcttcgagaacgtcatggatgaagtgttccgggacggtgtcaact
ggggccgcattgtagggctttttgcgttcggtggggcgctgtgcgtcgagtgtgtggagaaggagatgagtcagctggtg
ggaaggatcgtagagtggatgacagtctacctggacaaccacattcagccctggatccaaagccaaggaggatgggagcg
ctttgctgagctcttcggccacgacgcagcagcagagggcaggcggtctcaggagagtttcaagaagtggctgctggcag
gcatgaccctggtgactggggtcgtggtggggtcactcatagcgcagaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q1GZ93_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Anabas testudineus GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtggttttctacataacatataaactatcccagagaaactatcctctcaaccacttggg
actcaatgagactcccaacaggactgatgggggggaagatgggttgagtgaggaacagcggatagcaacgcacgccaacg
ggacttttaatggtagaagtcccgggacccccccagcgtccccgctgcggcaacaacggttgccatcaacgacgagcctg
gatgcggtgaaagaggccctccgggactcggccaacgagtttgagttacgatacgctcgagccttcagcgatctgcacaa
ccagctgcatatcacgcctgccacagcctaccaaagcttcgagaacgtcatggatgaagtgttccgggacggtgtcaact
ggggccgcattgtagggctttttgcgttcggtggggcgctgtgcgtcgagtgtgtggagaaggagatgagtcagctggtg
ggaaggatcgtagagtggatgacagtctacctggacaaccacattcagccctggatccaaagccaaggaggatgggagcg
ctttgctgagctcttcggccacgacgcagcagcagagggcaggcggtctcaggagagtttcaagaagtggctgctggcag
gcatgaccctggtgactggggtcgtggtggggtcactcatagcgcagaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q1GZ93_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Anabas testudineus GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtggttttctacataacatataaactatcccagagaaactatcctctcaaccacttggg
actcaatgagactcccaacaggactgatgggggggaagatgggttgagtgaggaacagcggatagcaacgcacgccaacg
ggacttttaatggtagaagtcccgggacccccccagcgtccccgctgcggcaacaacggttgccatcaacgacgagcctg
gatgcggtgaaagaggccctccgggactcggccaacgagtttgagttacgatacgctcgagccttcagcgatctgcacaa
ccagctgcatatcacgcctgccacagcctaccaaagcttcgagaacgtcatggatgaagtgttccgggacggtgtcaact
ggggccgcattgtagggctttttgcgttcggtggggcgctgtgcgtcgagtgtgtggagaaggagatgagtcagctggtg
ggaaggatcgtagagtggatgacagtctacctggacaaccacattcagccctggatccaaagccaaggaggatgggagcg
ctttgctgagctcttcggccacgacgcagcagcagagggcaggcggtctcaggagagtttcaagaagtggctgctggcag
gcatgaccctggtgactggggtcgtggtggggtcactcatagcgcagaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q1JZ46_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Anabas testudineus GN=BCL2L1 (length=660 residues).
atggaagaaatgtcgaacagtaacagagagctggtggagttcttcataatgtacaaactgtctcaaagaaaccacccagc
ctctcttctgaggccagatgataccggtggagtgggagacagacccaactcagcagctgctaacggcctgccggtcagca
ggagtggcgagctggggaactcgtcacctccgtgtaagagcatggaggccgtaaaaacagctcttagggactctgctgac
gagtttgaactgctcttcacacaagcgtttagtgacctttcctcgcagcttgatgtcacgcccgacacggcctatcaaag
ctttaagagtgtgatggacgagttgttcaaggatggagtcaactggggacgtatagtggggctgtttgccttcggtggcg
tgctgtgtgtggaatgtgtggagaagaatatgagtgagctggtatcccgaatcgcagactggatgaccatgtacctggat
gagcacatcagtccttggatccagagccagggaggatgggactgctttgctgagatatttgggcaagatgccgctgctga
ggcgaggagatctcgggaggctctgagaagatggctgctagttggagtggtgctgctcacgggagtgctgttaggtgtgc
tcattgctaagaaacggtga
>gnl|bcl2dbcds|A0A3Q1JZ46_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Anabas testudineus GN=BCL2L1 (length=660 residues).
atggaagaaatgtcgaacagtaacagagagctggtggagttcttcataatgtacaaactgtctcaaagaaaccacccagc
ctctcttctgaggccagatgataccggtggagtgggagacagacccaactcagcagctgctaacggcctgccggtcagca
ggagtggcgagctggggaactcgtcacctccgtgtaagagcatggaggccgtaaaaacagctcttagggactctgctgac
gagtttgaactgctcttcacacaagcgtttagtgacctttcctcgcagcttgatgtcacgcccgacacggcctatcaaag
ctttaagagtgtgatggacgagttgttcaaggatggagtcaactggggacgtatagtggggctgtttgccttcggtggcg
tgctgtgtgtggaatgtgtggagaagaatatgagtgagctggtatcccgaatcgcagactggatgaccatgtacctggat
gagcacatcagtccttggatccagagccagggaggatgggactgctttgctgagatatttgggcaagatgccgctgctga
ggcgaggagatctcgggaggctctgagaagatggctgctagttggagtggtgctgctcacgggagtgctgttaggtgtgc
tcattgctaagaaacggtga
>gnl|bcl2dbcds|A0A493TIA6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Anas platyrhynchos platyrhynchos GN=BCL2L1 (length=717 residues).
atgtccagcggcaaccgggagctggtgatcgactttgtctcctacaagctgtcgcagaaaggctacagctggagccagct
ggaggaagaggatgagaacaggactgagttggcttccgaggccgccgcggtgctcaacgggagcccctcctggcaccccc
cagccggccaggtagtgaacggcgccgccgtgcaccggagcagcctggaggtccacgagctcgttcaatcagccgccgtc
cggcaggctctgcgcgaagccggggacgaattcgagctgaggtaccgccgggctttcagcgacctcacctcccagctcca
catcacccccggcacggcttaccagagcttcgagcaggtggtgaacgaacttttccgcgatggggtgaactgggggcgca
tcgtggccttcttctccttcggaggggcgctgtgcgtggagagcgtggacaaggagatgagggtcctggtggggcgcatc
gtggcctggatgaccacctacctgagcgaccacctcgacccctggatccaggagaacggcggatgggtaagggggtgctc
cttctgcactcctctgggggatctgggctggatctggccccttagtgctctgcagataaccccccccccccgcccccccc
ccccccgcacccccccccgccccctccccctccctccctctctccctccctccctccctccaggcctgggcttttaa
>gnl|bcl2dbcds|H9GHK7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Anolis carolinensis GN=BCL2L1 (length=630 residues).
atgtcgagcagtaaccgagcgctcgtggtggacttcctttcctacaagctgtcgcagcggggccacagctggcatgagat
tgagatggagagcggggaggaagcgatggagccagcaaacgagacggggaacaccctcaatgggagcccttcttggcatc
ccagccccagccatgtcatcaatggggcctcagaacaccccgaactccttgaagaggaggaggaagaaaacccgagggtg
gatgtcagccagacacttagggaggctggcgatgagtttgaactaaggtaccggcgggcttttagtgacctgacctccca
gctccacatcaccttgggcacggcataccagagcttcgagcaggtggtgaatgaactcttccacgatggggtaaactggg
ggcggatagtggcattcttctcctttgggggagccctgtgcgtggagagcgttgacaaagagatgcaagggttggtggtg
aggattgccagctggatgaccacgtacctgactgaacacctggacccctggatccaagaaaacggtggctggaaatcaaa
ggggggacaaatcatttcagttatctacacgcatcattccgaagtctgtctgaacacttacattgattga
>gnl|bcl2dbcds|A0A2K5EBP4_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L1 (length=441 residues).
atgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatgctccacat
cacccccgggacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatggggtaaactggggtcgcattg
tggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
gcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaact
ctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtgg
ccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|A0A2K5EBP4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcactgagggaggcgggcgacgaatttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|E2IV75_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Aotus vociferans GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcactgagggaggcgggcgacgaatttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|A0A3P8P0F1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Astatotilapia calliptera GN=BCL2L1 (length=702 residues).
atgtctcaaaacagagaacttgtgcttttctacataaggtataaactctcccagagaaactatcctctcaaccacatagt
actcaacgagccttcgaacaggactgatgggggggcagcggggttggatgaggaacagcgaatagacacacacgccaatg
ggacttttaatggcacgagtcccgggaccccaccggcatccccgcagcggcggcagcagcagccgccatcaacgacggac
ctcgacgcagtgaaggaggcgctccgggacacggccaatgagttcgagctgcgatacgctcgtgccttcagcgaccttca
cagccagctgcacatcacgccggccacggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtta
actggggccgcatcgtagggcttttcgcgttcggcggggcactgtgtgtcgagtgcgtcgagaaggagatgagccccttg
gtgggcaggatcgtagagtggatgacggtctacctagacaaccacattcagccctggatccagagccaaggaggatggga
gcgcttcgctgaaatcttcgggcaggatgcggcggctgaaagccggaggtctcaggagagtttcaagaagtggctgctgg
tggggatgacggtggtgacaggcgttgtggcgggtgcgcttatcgcgcaaaaacgcctgtga
>gnl|bcl2dbcds|A0A3B1JJ42_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Astyanax mexicanus GN=BCL2L1 (length=720 residues).
gttatgtcgtactataaccgagaattagtggtgtactttattaagtacaaactctcacagaggaactatcctactaatca
catcggactcatggaagaaacaaatcgaactgaagggggccaggaagcggaggggaatgcagaggcggccggggtgactc
ccaccgcagtcgttaacgggtccgtaaatgggacgagtcacggtgcggcagggtcgcccacctcgtccccccagagaagg
gccaacggggctcgggggctggatgcagtgaaagaggcactgcgggactcagccaacgagtttgagctgcgatactctcg
cgccttcagcgacctgtcctcccagctgcacatcacgcctgctactgcgtaccagagctttgagagcgtgatggacgagg
tgtttcgcgatggcgtcaactggggccgcgtcgtaggtttgttcgctttcggcggggctctgtgtgtggagtgcgtggag
aaggagatgagccccctggtgggacgcatcgcagagtggatgaccgtctacttggacaaccacatccagccctggatcca
ggagcaaggaggatgggaacgctttgcagagatctttgggaacgacacagcagcagagagcagaaggatgcaggaacgct
ataagatgtggctgctggtggggatgaccctgttcacaggaattgtggtgggctctctcatcgctcagaagcgtctgtaa
>gnl|bcl2dbcds|L8J061_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bos mutus GN=BCL2L1 (length=702 residues).
atgtctcagagtaaccgggagctggtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggacagaatcagatatggaaacccccagtgccatcaatggca
acgcatcctggcacctggcggatagccctgctgtgaatggagccactggccacagcagaagctcggatgcccgggaagtg
atccccatggcagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacgtcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A3Q1LRT3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bos taurus GN=BCL2L1 (length=714 residues).
atgtctcagagcaatcgggaactagtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgtcagatatggaaacccccagtggatcagtggcaacccatcctggcacctggcagatagccccacagtgaatggag
ccactggccacagcagaagcttggatgcccggaaaatgatccccatgacaacagtaaagcaagccctgagggaggcaagc
aatgagtttaaactgaggtaccaacagacattcagcgacctgatgtcccagctccgcatcaccccagggacagcatgtca
gagctttgaacaggtaataaatgaactcttccgggacagggtgaaatggggtcacgttgtggcctttttctccttcagtg
ggacactatgcatgaaaagcatagacaaggagatacacgtattggtgagtcaggtcacaacttcaacggccacttaccta
aataaccacctcaagccttggatccaagagaacggcgggtgggacacttttgtggaactctacgaaagcaatacaacaaa
cgagagccagaagggccaagagcgtttcaactgctggtccctgacgacacgactgtggctgtttggcattttcttaatta
aacatatatttaccaaacaacccagcaattgtactcttgagcatttatctgggagatacgcaacattactgtag
>gnl|bcl2dbcds|Q05KJ0_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Bos taurus GN=BCL2L1 (length=702 residues).
atgtctcagagtaaccgggagctggtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggacagaatcagatatggaaacccccagtgccatcaatggca
acgcatcctggcacctggcggatagccctgctgtgaatggagccactggccacagcagaagctcggatgcccgggaagtg
atccccatggcagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacgtcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|Q05KJ0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bos taurus GN=BCL2L1 (length=702 residues).
atgtctcagagtaaccgggagctggtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggacagaatcagatatggaaacccccagtgccatcaatggca
acgcatcctggcacctggcggatagccctgctgtgaatggagccactggccacagcagaagctcggatgcccgggaagtg
atccccatggcagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacgtcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|F7IT34_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagcccagtggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcactgagggaggcaggcgacgagtttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|Q76LT7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcagacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaaacaagcgctgagggaggctggggatgagtttgaactgaggtaccggcgggcattcagtga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A452E1B1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Capra hircus GN=BCL2L1 (length=699 residues).
atgtctcagagcaaccgggaactagtggttgactttctctcttacaagtttttccagaaaggatacagctggagtcagtt
tagtgatatggaagagaacagaactgagaccctagaagggacagaatcagatatggaaacccccagcgccatcagtggca
acccatcctggcacctggcagatagctctgtggtgaatggagccactggtcacagcagaagcttggacgctgggaaaatg
atccccacggcagtggtgaagcaagccctgagggaggcaagcaatgagtgtgaattgaggtaccaacagacattcagcga
cctgacgtcccagctccacatcaccccagggacaacatatcagagctttgaacaggtaataaatgaactcttccaggatg
gggtgaactggtgtcgcaatgtggcctttttctccttcggtggggcactatgcatgaaaagcatagtcaaggagatgcag
gtattggtaagtcaggtcacgacttggatggccacttacctaaataaccacctagagccttggatccaggagaatggcga
ctgggacatttttgtggaactctacgaaaacaatacagcaaccgagagccaaaagggccaagagcacttcaaccgctggt
ccctgacggacgtgactgtggctggtatggctctgctgggcttgctcttcaacacataa
>gnl|bcl2dbcds|A0A452FHY1_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Capra hircus GN=BCL2L1 (length=723 residues).
atgtctcagagcaaccgagagctggtggttgactttctctcttacaagctttcccagaaaggattcagctggagcctcag
aagggacaaaatcagatatggaaaccccaatgccgtcaatgccaacccatcttggcacctggcgcatagccctgcggtga
atggagccactggccacacagaagaaagtggtcctgtggcaacagcacagcaagccccgagggaggcaggcagcgagttt
gaactgaggcaccaacagacggtcagcgacctgacgtcccagctccacaccaccccagggacagcatatcagagctttga
acaggtaatgtatgagctcttctgggacggggtgaactgggatcacactgtggcctttttctccttcaggggggcactat
gcatggaaagcgtagacaaggagatgcaggtattggtgagtcaggtcatgacttggatggccagccagctaaatgaccac
ctagagccttggatccaggagaatggcggctgggacacttctgtggaattctgtgaaaacaatacagcaaccgagagcca
aaagggccaggagcgcttcaactgctggtccctgacggctgtgactttggctgggctcgctcttcaactcatagtgactg
ttcctttcattacagtcattcatgttttgcacaagcttgtgttcccttccttttgttacagctatagagaccttacaatt
taa
>gnl|bcl2dbcds|A0A452FHY1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Capra hircus GN=BCL2L1 (length=699 residues).
atgtctcagagcaaccgagagctggtggttgactttctctcttacaagctttcccagaaaggattcagctggagcctcag
aagggacaaaatcagatatggaaaccccaatgccgtcaatgccaacccatcttggcacctggcgcatagccctgcggtga
atggagccactggccacacagaagaaagtggtcctgtggcaacagcacagcaagccccgagggaggcaggcagcgagttt
gaactgaggcaccaacagacggtcagcgacctgacgtcccagctccacaccaccccagggacagcatatcagagctttga
acaggtaatgtatgagctcttctgggacggggtgaactgggatcacactgtggcctttttctccttcaggggggcactat
gcatggaaagcgtagacaaggagatgcaggtattggtgagtcaggtcatgacttggatggccagccagctaaatgaccac
ctagagccttggatccaggagaatggcggctgggacacttctgtggaattctgtgaaaacaatacagcaaccgagagcca
aaagggccaggagcgcttcaactgctggtccctgacggctgtgactttggctgggggatcaggactcagcaggaaggcag
ctgtctctaaagataccccttggctcaccttcccctctccccatgctcaagcctactga
>gnl|bcl2dbcds|A0A452FWV3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Capra hircus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggacagaatcagatatggaaacccccagtgccatcaatggca
acccatcttggcacctggcggatagccctgcggtgaatggagccaccggccacagcagaagcttggatgcccgggaagtg
atccccatggcagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacgtcccagctccacattaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggctacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacgtttgtggaactctatgggaacaacgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A250YD48_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Castor canadensis GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaataggactgaggccccagaagggattgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcagtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatgacagcagtgaagcaagcgctgagggaggcaggtgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacataaccccggggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggctacttacctgaatgaccacctagaaccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A1L5BWY3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Castor fiber GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaataggactgaggccccagaagggattgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatgacagcagtgaagcaagcgctgagggaggcaggtgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacataaccccggggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggctacttacctgaatgaccacctagaaccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcagcagctgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A286Y5D6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cavia porcellus GN=BCL2L1 (length=702 residues).
atgtctcaaagcaactgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaaggcccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacctaactgatagtcccacggtgaatggggccactggccacagcagtagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagctcttagggaggcgggcgatgagtttgaacttcggtaccggcgagcattcagcga
cttaacatctcagctccacatcaccccggggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcattgtgcgtggagagcgtagacaaggagatgcag
gtattggtgaggcggatcgcaagctggatggctacttacctgaatgaccacctagaaccttggatccaggacaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tgctgacgggcgtgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5Q6R6_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Cebus capucinus imitator GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcactgagggaggcgggcgacgagtttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcatatcaaagctttgaacaagtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|A0A2K5Q6R6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cebus capucinus imitator GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcactgagggaggcgggcgacgagtttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcatatcaaagctttgaacaagtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|A0A2K5Q6R6_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Cebus capucinus imitator GN=BCL2L1 (length=441 residues).
atgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatgctccacat
cacccccgggacagcatatcaaagctttgaacaagtagtgaacgaactcttccgggatggggtaaactggggtcgcattg
tggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
gcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaact
ctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtgg
ccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|A0A2K5M8B1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cercocebus atys GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5M8B1_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Cercocebus atys GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtgaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A0D6DR75_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Channa striata GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtggtttactacataacatataaactgtcggagaaaaactatcctctcaaccacttggg
actcagtgagcctccaaacaggactgatggaggggaggttgagtccgctgaggaacagcggatagcgacgcacgccaacg
gtacttttaacggaagaagtcctggaacccccccagcatccccgctcaggcaacaacggttgccatcaccgacgagcctg
gatgcggtgaaagaggccctccgggactcagccaatgagtttgagctgcgatatgcccgcgccttcagcgatctgcacaa
ccagctgcatatcacgcccgccacggcctaccaaagctttgcgaacgtcatggatgaagtgttccgggacggcgtcaact
ggggccgcatcatagggctctttgcatttggtggggcactgtgtgttgagtgtgtggagaaggagatgagtcagctggtg
gtcaggatcgtagagtggatgacagtgtacctggacgaccacattcagccctggatccaaagtcaaggaggatgggagca
ctttgctgaaatcttcgggcatgatgcagctgcagagagcaggaggtctcaggagagtttcaagaagtggctgctggcgg
ggatgacggtggtgacgggcgttgtggctggtgctcttatcgcgcaaaaacgcctgtga
>gnl|bcl2dbcds|A0A0D9RJZ8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Chlorocebus sabaeus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaaacgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A059PJI5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Clarias batrachus GN=BCL2L1 (length=717 residues).
atgtcttactacaacagagaacttgtcgtgtacttcatcaagtacaagctctcccagaaaaactacccctgcgaccacat
cggcctcacggaagaggtgaacggccaggtggcggaagagaacgcggtgggagcgggagagtcggagacgccgacagcag
tcgttaatggcaccctaaacgggaccggatcggcaggcactccaccgcgatcgccgactttgtcccctcagaggcaggtg
aatggcagcgcaagcctggaggcagtaaaggaggcgctacgtgactctggcaatgagttcgagctgcgctattcacgcgc
ctttagcgacctgtcatcacagttgcatataactccagtcacggtgtaccagagctttgagagcgtgatggacgaggtgt
tccgcgacggcgtcaactggggccgtatcgtgggcttgttcgcttttggaggtgccctctgtgtcgagtgtgtggaaaag
gagatgagtccgctggtggcacgtatcgccgagtggatgaccgtctacctggacaaccacatccagccctggattgaaga
gcaaggaggatgggaacggtttgcagagatctttgggaaagatgcagcagcagaaggcagaaggtcacaggaaagcttta
agaagtggctgctggcaggtgtgacactcttcacgggggtggtggtgggctccttcatcgctcagaagcgcctgtaa
>gnl|bcl2dbcds|A0A2K5H963_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctagtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagctgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5H963_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcaact
tggatggccacttatctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
tgggaacaatgcagcagctgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|B2Z3Z4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cricetulus griseus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctagtggttgactttctctcctacaagttctcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaacaggactgaggccccagaaggaactgaatcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtaaatggagccactggccacagcagcagtttggatgcacgggaggtg
atccccatggcagccgtaaagcaagcgctgagagaggccggcgatgagtttgagctgcggtaccggcgggcgttcagtga
tctaacatcccagcttcatataaccccagggactgcatatcaaagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggtggagccctctgtgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggacaacggcgg
ctgggacactttcgtggaactctacggaaacaatgcagcagctgagagccggaaaggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctctctcttcagtcggaagtga
>gnl|bcl2dbcds|G3HEA7_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Cricetulus griseus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctagtggttgactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaacaggactgaggccccagaaggaactgaatcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtaaatggagccactggccacagcagcagtttggatgcacgggaggtg
atccccatggcagccgtaaagcaagcgctgagagaggccggcgatgagtttgagctgcggtaccggcgggcgttcagtga
tctaacatcccagcttcatataaccccagggactgcatatcaaagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggtggagccctctgtgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggacaacggcgg
ctgggacactttcgtggaactctacggaaacaatgcagcagctgagagccggaaaggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctctctcttcagtcggaagtga
>gnl|bcl2dbcds|G3HEA7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cricetulus griseus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctagtggttgactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaacaggactgaggccccagaaggaactgaatcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtaaatggagccactggccacagcagcagtttggatgcacgggaggtg
atccccatggcagccgtaaagcaagcgctgagagaggccggcgatgagtttgagctgcggtaccggcgggcgttcagtga
tctaacatcccagcttcatataaccccagggactgcatatcaaagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggtggagccctctgtgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggacaacggcgg
ctgggacactttcgtggaactctacggaaacaatgcagcagctgagagccggaaaggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctctctcttcagtcggaagtga
>gnl|bcl2dbcds|A0A345BSW9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ctenopharyngodon idella GN=BCL2L1 (length=627 residues).
atgtcttactataacagagaactagtggtattttttattaaatataaactctcgcagaggaactacccctgcaaccacat
tgggcttacagaagacacaaatcggactgatggggccgaagagaatggtgagggggcggcaggaacgacgaccctcgtta
acggctccatgaacagaaccccaccacaatcccccgctacatccccccagcatcagacaaacgggagtgggggtctggac
gcggtgaaggaagcactacgcgattctgccaatgagtttgagctgcgttattcccgagcgttcaacgacctttcctcaca
gctccacatcacacctgccacggcataccagagctttgagagcgtgatggatgaggtgttccgcgacggcgtcaactggg
gccgcatcgtgggactgtttgccttcggaggggctctgtgcgtcgagtgtgtggagaaggagatgagcccattagtggga
cgcattgcagaatggatgaccgtctacctggacaaccacattcagccctggatccagagccaaggaggatgggtgagtgg
aaaattacttgcatttctttcctaccttgttccctttcttcagtttaatcacaaagagcctttgtaa
>gnl|bcl2dbcds|A0A3P8UWG7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cynoglossus semilaevis GN=BCL2L1 (length=708 residues).
actttgacctttaatattaacagaaaactggtggtcgactacatacagtataaactttcccagaggaactttcccgtcca
ccacctgggactcggtgattctccaaacaggactgatggggaagaggcagggttgggcgcagagcagcggacaagtacgc
acgccaacgggactgtaaacggcacaagttctgggacgccgcctgcatctccactgcggcagcagcattcggcgtcggat
acaagtctggactccattaaagaggctctgcgggactcggccaacgagtttgaactgcgatacgcgcgggccttcagcga
tctgcaccagcagctgcacatcacaccagccactgcctaccaaagtttcgagaatgtgatggacgaagtgttccgggacg
gtgtcaattggggtcgcatcatagggctcttcgccttcggcggggcgctgagtgtcgagtgcgtggagaaagagatgagt
cagctggtggccaggattgcggattggatgacagtctatcttgacaaccacatccagccatggatcgaaacccaaggtgg
atgggagcattttgcggaactctttggtcaggatgcagcagcggagagccggaggtcacaggagagttttaagaaatggt
tgctggctgggatgacgctggtgacaggcgtggtggtgggctccctgattgcccagaaacgtctctga
>gnl|bcl2dbcds|A0A3P8VMA1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cynoglossus semilaevis GN=BCL2L1 (length=645 residues).
atgtcgtgcagtaacagagaattggttaagttctttttaggttataagctttctcagaggaactacccagaatctcttct
gatgttgaggattgggggagaacagcgtgaaggtgaggaggtcaccacagcgtccagtaatggcgttcctcagactcctt
cagctgtgctgcagcactgcagtggtgcagaggctgtaaaggctgctctcaaggactcagctgacgagtttgaacttcgc
ttcacacaagcctttcgtaaccttttcttaaagctggacctcactccggacacagtctaccacagttttaagagcgtgat
ggatgaggtcttcagagacggagtcaactggggacgcatagtcggcctgtttactttcggaggagtactgtgtgtggaat
gtgtgcagaggaatatgagtgagttagttccccgcattgcagactggatgaccatgtacttggatgaatacattgatcca
tggatccagagccaaggaggctgggaccgttttgctgagatttttggcacagactgtattccaagaacgaggagttgtcg
ggacacagtgagaagatggctgctagtgggagcaggcctgcttgcagcagtgttgattggtgttctgatcactaaaaagc
attga
>gnl|bcl2dbcds|A0A3Q2C6K4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cyprinodon variegatus GN=BCL2L1 (length=660 residues).
atgtcatacagtaacagagaactggtagagttctatataagctacaaactgtctcagacaaactgcccaaactctctgct
gaggtcggaggtcactggtggccggaccgagggagacaaggacgcctcggcttccagcaatggcccacttttcaacagca
ggcccagcccccccgggaagcctcgggccccccatggaagcatagaggctgtaaaatccgctctgaaggactcagcaaat
gagtttgaacttctcttctctcaaagtttcagtgacctctccatgcagctagacatcacccctgacacggcctaccacag
ctttaaggccgtgttggacgagttgttcaaggatgggatcaactggggccgtgtggtggggctgtttgcctttggtgggg
ttctgtgtgtgcactgcgtgcagaagaatatgagtgagttggtgtcccgcattgcagactggatgaccatttacctagat
gagcagcttaacccttggatccacagccagggaggatgggactgctttgctaagctgtacggccaagacgccgctgcaga
ggggcggagatctcacgagacattgaacaaatggctgctagttggtgcggctctgctcggcggagttctgctcactgtgc
ttgttgctaagaaacgatga
>gnl|bcl2dbcds|A0A3Q2FR43_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cyprinodon variegatus GN=BCL2L1 (length=681 residues).
atgtctcagaacagagaactggtccttttctacattaagttcaaactgtctcagaggaactatcccgtcaaccacataat
gctcaacgagccgcccaacggcaccggcgcccagggggcggagcaggacgacgagcgtacgccggagacgcacgctaacg
ggacttttaacgggaccagtccaggctccccgcggcgacagcaggcgtccacagccgccatggaggcggtgaaggcggcg
ctgagagacacggcctgcgagttcgagctgcgctacgcccgcgccttcaacgaccttcacagcacgctgcacatcacgcc
ggccaccgcctaccagagcttcgagaacgtgatgaacgaggtgttccgggacggcgtcaactggggccgcatcgtgggcc
tgttcgccttcggcggagcgctgtgcgtggaatgcgtggagaaggagatgagtcccctggtggggcggatcgtggagtgg
atgaccgtctacttggatgagcagatcgatccctggatccagagccaaggaggatgggaacgctttgctgaaatcttcgg
aggcgacgcagcggctgagagcagaaggtctcaggagagcctgaagaactggctgctgctggggatgagcgtggccaccg
ccctcatagccggctccatcttcgcccacaaacgcctgtga
>gnl|bcl2dbcds|Q90Z98_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Danio rerio GN=BCL2L1 (length=717 residues).
atgtcttactataaccgagaactggtggtattttttatcaaatataaactctcgcagaggaactacccctgcaaccacat
tggacttacagaagacacaaatcggactgatggggctgaagagaatggcgagggggcagcaggagcgacaactcttgtta
atggcaccatgaatagaacgaacgctagttccactgggaccccaccacaatcccctgcttcatccccccagcgtcaaaca
aatgggtctgggggtctagacgcagtgaaggaggcgctccgtgattctgccaacgagtttgagctgcgctattccagagc
attcaacgatctttcctcacagctccacatcacacccgccacagcgtaccagagcttcgagagcgtgatggatgaggtgt
ttcgcgacggcgtcaactggggccgaatcgtggggttgttcgcattcggaggggctctgtgcgtcgagtgtgtggagaag
gagatgagtccgcttgtgggacgcatcgcagaatggatgaccgtctacctagacaaccatattcaaccctggatccaaag
ccaaggaggatgggaacgctttgcagagatctttggaaaagatgcagcggcggaaagcaggaaatcgcaagaaagcttca
agaaatggttgtttgcaggaatgaccttgctcacgggtgtcgtcgttgggggactcattgcacagaaacgcctgtga
>gnl|bcl2dbcds|Q90Z98_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Danio rerio GN=BCL2L1 (length=717 residues).
atgtcttactataaccgagaactggtggtattttttatcaaatataaactctcgcagaggaactacccctgcaaccacat
tggacttacagaagacacaaatcggactgatggggctgaagagaatggcgagggggcagcaggagcgacaactcttgtta
atggcaccatgaatagaacgaacgctagttccactgggaccccaccacaatcccctgcttcatccccccagcgtcaaaca
aatgggtctgggggtctagacgcagtgaaggaggcgctccgtgattctgccaacgagtttgagctgcgctattccagagc
attcaacgatctttcctcacagctccacatcacacccgccacagcgtaccagagcttcgagagcgtgatggatgaggtgt
ttcgcgacggcgtcaactggggccgaatcgtggggttgttcgcattcggaggggctctgtgcgtcgagtgtgtggagaag
gagatgagtccgcttgtgggacgcatcgcagaatggatgaccgtctacctagacaaccatattcaaccctggatccaaag
ccaaggaggatgggaacgctttgcagagatctttggaaaagatgcagcggcggaaagcaggaaatcgcaagaaagcttca
agaaatggttgtttgcaggaatgaccttgctcacgggtgtcgtcgttgggggactcattgcacagaaacgcctgtga
>gnl|bcl2dbcds|E6ZFR0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Dicentrarchus labrax GN=BCL2L1 (length=663 residues).
atgtcgtacagtaacagagagctggtggagttctttataagctataaactgtctcagaggaaccacccaacctctctact
gaggccggagaatgccggtgaaaggactgagggagacaaggccaactcagctgccagaaacggcttgctggccagcaaga
acacaagtggccagccggggacgtcttcgtcctcaggcgctgacatagaggctgtaaaggcagctcttcgggactcggca
gatgagtttgaactgctcttcacgcaagcgtttagtgacctttcctcgcagattgacatcactcctgacacggcctacca
cagctttaaaagcgtgatggacgaggtgttcaaggatggagtgaactggggacgtatagtgggcctgtttgcctttggcg
gtgtactgtgtgtagaatgtgtcgagaaagatatgagtgagctggtttcccgcatcgcagactggatgaccatgtacctg
gatgagcacatcagtccgtggatccagagccaaggaggatgggactgctttgctgaggtttttgggcgagacgccgccgc
agaagcgaggagatctcgggagactctgagtagatggctgctaattggggtggcgctgctaatgggagctgtggtcgggg
ttctcattgctaagaaacattga
>gnl|bcl2dbcds|A0A1S3EPX7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Dipodomys ordii GN=BCL2L1 (length=705 residues).
atgtctcagagcaaccgtgagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagagcaggactgaggacccagaaggaactgaatcggagatggagacccccagtgctatcaatggca
acccatcctggcacctggcggacagccccgcggtggtgaatggagccacgggtcacagcagcagttcggaagcccgggaa
gtgattcccatggcagctgtgaagcaagcgctgagggaggcaggcgatgagtttgaactgcggtatcgacgggcattcag
tgacctgacatcccagctccatattaccccggggacagcatatcagagctttgagcaggtagtgaacgaactcttccggg
atggggtaaactggggtcgaattgtggcctttttctccttcggcggggcactgtgtgtggaaagcgtagacaaggagatg
caggtattggtgagtcggatcgcaagttggatggccacttacctgaatgaccacctagagccttggatccaggagcacgg
cggctgggacacttttgtggaactctacgggaacaatgcagcagctgagagtcggaagggccaggagcgcttcaaccgct
ggttcctgacgggcatgaccgtggccggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A219P0Y3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Epinephelus coioides GN=BCL2L1 (length=699 residues).
atgtgtcaaaacagagaactggtggtttgctacataaaatataaactaacccagagaaactatcctctcaaccacatggg
actcatagagcctccaaacaggactgatgggggggaggcagggttaggtgaggagcagcgggtagcgacacacgccaacg
ggacttttaatggcatgagtcccgggaccccgccagcatccccgctgcggcagcaacagttgccatcaacaacgagcctg
gacgcggtgaaagaggccctccgggactccgccaacgagtttgagctgcgatacgctcgcgccttcagcgatctgcacca
ccagctgcacatcacgccggccacagcctaccaaagcttcgagaacgtgatggatgaggtgttccgggacggagtcaact
ggggccgcatcgtagggcttttcgctttcggcggggcgctgtgcgtggagtgcgttgagaaggagatgagtccgttggtg
ggcaggatcatagagtggaagacccgctatctggacaaccacattcagccctggatccagagccaaagaggatgggagcg
cttcgccgaaatcttcgggcaggacgcggcggcagagagcaggaggtctcaggagagtttcaaaaagtggctgctggcgg
ggatgaccctggtgaccggagttgtggtgggctcactcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q2H0F6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Equus caballus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacaactggagtcagtt
tagtgacgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccacggggaatggagccactggccacagcagcagcttggatgcccgggaagtg
atccccatggcagcagtgaagcaagcgctgagggaggcaggcgatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacctggatggccacttacctgaatgaccacctagagccttggatccaagagaacggcgg
ctgggacacctttgtggaactctacgggaacaacgcggcagccgaaagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcactcttcagtcggaagtga
>gnl|bcl2dbcds|A0A3Q2H0F6_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Equus caballus GN=BCL2L1 (length=738 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacaactggagtcagtt
tagtgacgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccacggggaatggagccactggccacagcagcagcttggatgcccgggaagtg
atccccatggcagcagtgaagcaagcgctgagggaggcaggcgatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacctggatggccacttacctgaatgaccacctagagccttggatccaagagaacggcgg
ctggaaagaaactgctttggggaccttctgctacttcgtttcatccctgatgagactctcaggccaaggcggagccttac
agctagctccaagctacagtgctttttgggcagactccagagctcccctcggaactagaggtttttctctcgctcttcag
gaaatgccattgcaatga
>gnl|bcl2dbcds|A0A1S2ZQT6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Erinaceus europaeus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggcctcagaaggaactgaatcagagatggaaacacccagtgccatcaatggca
acccatcctggcacctggcggacagccctgcattgaatggagctactggccacagcagcagcctggatgcccgggaggtg
atccccatggcagccgtgaagcaagcgctgagggaggcgggtgatgagtttgaactaaggtatcggcgggcattcagtga
cctgacttcccagctccacatcaccccagcaacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaatggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagctgagagccgaaagggacaggagcgcttcaaccgctggt
tcctgacgggcgtgactgtggctggcttggttatgctgggctcactcttcagtcgaaaatga
>gnl|bcl2dbcds|A0A3P8XFS0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Esox lucius GN=BCL2L1 (length=660 residues).
atgtcttacagtaatagggaactggtggtgttttttataaactataaactgtcccagaggaattattcctgttgtgaatt
ggagctggagggtgcaagtggacggactgagggagaagaggctactgcaaatgggtctgtggggaacggcaggaacagca
gacgcaatttgggaaagccctcaactccacaggggtgcatggaggcagtgaaagcagcactacgggactctgcagatgag
tttgagctgcgctacacccgtgccttcagtgatctctcctcccagctccacatcacccccgccacagcctaccacagttt
tgaaagtgtgatggacgaggtgttcagggatggggttaactggggtcgtgtggtgggcctgtttgctttcggcggggccc
tatgtgttgagtgtgttgagaaggatatgagcctcctagtggcacgtattgcagactggatgaccacctacctggacgaa
cacatccagccctggatccaaattcaaggaggatgggatcgttttgctgacatttttggcagagatgcagctgcagacat
ccgacgttcccaagaaagcttgaggaaatggctgctatttggggtgatgctgctttcaggagtgctggttggcactctcc
tcatgaagaaacgccagtaa
>gnl|bcl2dbcds|A0A3P8XFS0_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Esox lucius GN=BCL2L1 (length=627 residues).
atgtcttacagtaatagggaactggtggtgttttttataaactataaactgtcccagaggaattattcctgttgtgaatt
ggagctggagggtgcaagtggacggactgagggagaagaggctactgcaaatgggtctgtggggaacggcaggaacagca
gacgcaatttgggaaagccctcaactccacaggggtgcatggaggcagtgaaagcagcactacgggactctgcagatgag
tttgagctgcgctacacccgtgccttcagtgatctctcctcccagctccacatcacccccgccacagcctaccacagttt
tgaaagtgtgatggacgaggtgttcagggatggggttaactggggtcgtgtggtgggcctgtttgctttcggcggggccc
tatgtgttgagtgtgttgagaaggatatgagcctcctagtggcacgtattgcagactggatgaccacctacctggacgaa
cacatccagccctggatccaaattcaaggaggatgggatcgttttgctgacatttttggcagagatgcagctgcagacat
ccgacgttcccaagaaagcttgaggaaatggctgctatttgggatggaaaatgcgcaatggacctga
>gnl|bcl2dbcds|A0A3P8XYL5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Esox lucius GN=BCL2L1 (length=693 residues).
atgacttacaacaacaaagaactggtggcatactatattacctataaactatcccagagaaactaccccatcaatcacac
tgggctcacaggagcatttgatcggactgaggggggagaggtggaagaggtggcagcagtcaccatgcaccccaatggca
caatgaatgggacgagtcctgggactccaacacaacagtcccccccctcatctcctcggcggactgttggcctggatgca
gtgaaagaggcactgcgggactctgccaacgagtttgagctgcgttacgccctagcattcagtgacctgtcatcccagct
gcacctcacaccggctacagcctaccagagctttgcaagtgtgatggatgaggtgttccgggatggggtgaactggggaa
gggttgtgggcctgtttgcgttcggaggggccctctgtgtagagtgcgtggagaaggagatgagcccccttgtgggacgg
attgctgactggatgaccgtctacctggataaccacatccagccctggatcgagagccaaggaggatgggaccgttttgc
agagatctttgggaaggatgctgcagccaacagcaggaagtctcaggagagctttaagaagtggctgctggcaggaatga
cgctggttacaggagttgtcgttgggtctcttattgctcagaaacgcctgtga
>gnl|bcl2dbcds|M3XA94_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Felis catus GN=BCL2L1 (length=675 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaagcaggcgctgagggaggccggggatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggtctggactggcttattttaccctgagttcctggcacagggcctgaggttgggtaagggcttggccagcatctgct
caatgaacatgaggttattattagatgcaggttag
>gnl|bcl2dbcds|M3XA94_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Felis catus GN=BCL2L1 (length=744 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaagcaggcgctgagggaggccggggatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggttgttattgagcaccaacggtgtgccaggctctgtgctccacagggtgcacacagcccagaacaaagcagcccat
ggagcacctcttctagagaaaggagacacgacggacaaggaaacaaacaagattgttccggggataaattgttctgcaac
caactaccccaaaacttaagctaa
>gnl|bcl2dbcds|M3XA94_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Felis catus GN=BCL2L1 (length=816 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaagcaggcgctgagggaggccggggatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcggccgagagccggaagggccaggtcagaacaaacgccgaaa
cagagctgccacagagagtttgtccggtcctggggacgacgccttgcctggatttcgctgggacgggaagggactgttgg
cctggaaggtggaggaaacctcctttgggcgggtctgaccactctgcacagctcccgtcccagggcagaagttcccggag
gagggggcggtgctga
>gnl|bcl2dbcds|Q8SQ42_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Felis catus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcggtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcagacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtcaaacaagcgctgagggaggctggggatgagtttgaactgaggtaccggcgggcattcagtga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgctccaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|U3JSL7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ficedula albicollis GN=BCL2L1 (length=693 residues).
atgtacagcagtaatcgggagttagtgattgactttgtttcttacaagctctcacagaaaggctacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcaggggaggaggacgagatggacggcgtgctcaacggaagcccctcct
ggcacgcacccaccagccacatagtgaacggagcctccgtgcaccagagcagcctcgaagtccatgagatccgtcgagca
gccgacgtgaggcaggcgctgagagaggcgggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcacttc
ccagctccacatcactcccagcacagcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgttaaggagatgcgggtattggtg
aaacgcatcgtgtcttggatgaccacgtacttgaccgaccacttagatccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacgatgctgctgccgaggtgagaaaaggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggccggagtgcttctgctgggatcgctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A3Q2NRP4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Fundulus heteroclitus GN=BCL2L1 (length=660 residues).
atgtcatatagtaacagagaactggtggagttctacataagctacaaattgtcccagacaaactgtccaaactctctgct
gaggtccgaggttgctggcgataggaccgagggggacaaggactccccggcttctagcaatggccctctggtcagcagct
gggccggctccccgtggcagccttgggcccctcatggccgcgcggaggctgtgaagtcggctctgagggactcggcggat
gagtttgaacatctcttcacccaaagtttcagtcacctctccctgcagctggacatcacccccgacacggcctaccacag
cttcaaggccgtgctggacgagttgttcaaggacggggtcaactgggggcgcgtggtggggctgtttgccttcggcgggg
ttctgtgtgtggactgcgtccagaagaacatgagcgagctggtgccccgcatcgcagactggatgaccatttacctggat
gagcagctcgacccctgggtccgcagccaggggggatgggaatgctttgctaagctgtacggccaggacgccgccgcagc
gggccggaggtttcaggagacgttgaacaaatggctgctagtcggcgcggctctgctaaccggatttctgctcgtcgtgc
tcttcgccaagaaacgatga
>gnl|bcl2dbcds|A0A3Q2QPL9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Fundulus heteroclitus GN=BCL2L1 (length=690 residues).
atgtctcaaaaccgagaactggtgctgtcctacgtcaagtttaaactgtctcagaggaactatcccgtcaaccacataat
gctcaacgagccgcccagcgacggcggcgccagggacgcagagtctgacgaggagcagacggcggagacgcacgccaacg
ggaccgtcaacgggaccagctcgggctccccgcggcggcggcagcagcagccggcgtccacggcggcgatggaggcggtg
aaggtggcgctgcgggagacggcctgcgagttcgagctgcgctacgcccgcgccttcaacgacctgcacagcacgctgca
catcacgccggccaccgcctaccagagcttcgagaacgtgatgaacgaggtgttccgggacggcgtcaactggggccgca
tcgtggggctgttcgcgttcggcggcgcgctctgcgtggagtgcgtggagaaggagatgagtcccctggtgggccgcatc
gtggagtggatgaccgtctacctggacgagcagatcgacccctggatccagagccagggaggatgggagcgctttgctga
aatctttgggggcaacgcagcggcggagagcagaaggtctcaggagagcttcaagaactggctgctgctggggatgagcg
tggtgacggccttcatagccggctccatcttcgtccagaaacgcctgtga
>gnl|bcl2dbcds|D2ITA2_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Gadus morhua GN=BCL2L1 (length=684 residues).
atgagcattgacacaagcatgtcgatcagtaacagagaactggtgttcttcttcctaagccataaactgtctcagaggaa
ttacaggcctattcccttccagcccgagggggcaggtgaggggactgatgaggacaagtccaacaggattggtaataatg
ggttacggttgaacgacggtaacggcaatggccagttggcgccatcacctactccacaaggcacggaggctgtgagggca
gcgcttctagaatcggtggaagagtttgagttgcgctacacgctggccttcagcgacctgtcgtcccagctgcccatcac
ccccgccacggcctacggtagcttcgaaagcgtgatggacgaggtgttcagggacagcatcaactggggacgcatagtgg
gcctgtttgccttcgggggggccctctgcgtggagtgtgtggagaaggagatgagccacatggtgccccgcgtggcagag
tggatgaccaggtacctggacgaccacattgaccactggatccagagcaacggaggatggaaacactttgctgcggtttt
tggaagcgacgcggcagcgggagcgaggcgtacccgggacagtcacaggagatggatgctggtgggcgcggcgctgctga
ctggggtgctgctcggggctctgctcgccaagaaacatgtctag
>gnl|bcl2dbcds|Q07816_BCL2L1-04 BCL2-like 1 gene OS=[Eukaryota] Gallus gallus GN=BCL2L1 (length=690 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagagggggcactgctggagcgagct
ggaggaagaggatgagaacaggactgacactgcagctgaggcagagatggacagcgtcctcaatgggagcccatcctggc
acccccctgccggccacgtagtgaacggagccaccgtgcaccggagcagcctggaagttcatgaaattgttcgagcatcc
gacgtgaggcaggcgctgagagatgcgggggatgagtttgagctgaggggctttgtgcgtggagagcgtggacaaggaga
tgcgggtactggtgggacgcattgtgtcttggatgaccacgtacttgaccgaccatctagatccctggatccaggagaat
ggcggctgggagcgctttgtggatctgtatgggaacaacgctgctgccgagctgaggaagggccaggagaccttcaacaa
atggctcctcaccggggcgaccgtggccggagtgcttctgctgggatccctgctgagccgcaagtgaccccatggttgtg
tcccctggcaccaggatggctgcgccttcacacatccaccacgcagctcccgagcaccatcaccatcacggggcgctcac
cccgctccacggagcttccttcctcgcgccgccagctccttttgtcgtag
>gnl|bcl2dbcds|Q07816_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Gallus gallus GN=BCL2L1 (length=690 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagagggggcactgctggagcgagct
ggaggaagaggatgagaacaggactgacactgcagctgaggcagagatggacagcgtcctcaatgggagcccatcctggc
acccccctgccggccacgtagtgaacggagccaccgtgcaccggagcagcctggaagttcatgaaattgttcgagcatcc
gacgtgaggcaggcgctgagagatgcgggggatgagtttgagctgaggtaccggagggctttcagcgacctcacctccca
gctccacatcacccctggcacggcgtaccagagctttgagcaggtagtgaatgaactcttccatgatggtgtgaactggg
ggcgcatcgtggctttcttctccttcggaggggctttgtgcgtggagagcgtggacaaggagatgcgggtactggtggga
cgcattgtgtcttggatgaccacgtacttgaccgaccatctagatccctggatccaggagaatggcggctgggagcgctt
tgtggatctgtatgggaacaacgctgctgccgagctgaggaagggccaggagaccttcaacaaatggctcctcaccgggg
cgaccgtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|Q07816_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Gallus gallus GN=BCL2L1 (length=690 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagagggggcactgctggagcgagct
ggaggaagaggatgagaacaggactgacactgcagctgaggcagagatggacagcgtcctcaatgggagcccatcctggc
acccccctgccggccacgtagtgaacggagccaccgtgcaccggagcagcctggaagttcatgaaattgttcgagcatcc
gacgtgaggcaggcgctgagagatgcgggggatgagtttgagctgaggtaccggagggctttcagcgacctcacctccca
gctccacatcacccctggcacggcgtaccagagctttgagcaggtagtgaatgaactcttccatgatggtgtgaactggg
ggcgcatcgtggctttcttctccttcggaggggctttgtgcgtggagagcgtggacaaggagatgcgggtactggtggga
cgcattgtgtcttggatgaccacgtacttgaccgaccatctagatccctggatccaggagaatggcggctgggagcgctt
tgtggatctgtatgggaacaacgctgctgccgagctgaggaagggccaggagaccttcaacaaatggctcctcaccgggg
cgaccgtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|Q07816_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gallus gallus GN=BCL2L1 (length=690 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagagggggcactgctggagcgagct
ggaggaagaggatgagaacaggactgacactgcagctgaggcagagatggacagcgtcctcaatgggagcccatcctggc
acccccctgccggccacgtagtgaacggagccaccgtgcaccggagcagcctggaagttcatgaaattgttcgagcatcc
gacgtgaggcaggcgctgagagatgcgggggatgagtttgagctgaggtaccggagggctttcagcgacctcacctccca
gctccacatcacccctggcacggcgtaccagagctttgagcaggtagtgaatgaactcttccatgatggtgtgaactggg
ggcgcatcgtggctttcttctccttcggaggggctttgtgcgtggagagcgtggacaaggagatgcgggtactggtggga
cgcattgtgtcttggatgaccacgtacttgaccgaccatctagatccctggatccaggagaatggcggctgggagcgctt
tgtggatctgtatgggaacaacgctgctgccgagctgaggaagggccaggagaccttcaacaaatggctcctcaccgggg
cgaccgtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|G3NJY1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gasterosteus aculeatus GN=BCL2L1 (length=573 residues).
atgtctcaaaacagagaactggtggttttctacataaactataaactctcccagaggaacttacccctcaaccacatagg
gctgtccgagcctcccaacaggactggcgggggggtagaggcaggggcggctggtgggcagcggggagcgacgcactcca
acgggactttcaacggcacgagtcccgggaccccgccggcgtccccgctgctccagcaacggtcgccgtcgacggcgagc
ctggatgcggtgaaggaggccctgcgggactcggccaacgagttcgagctgcgatacgctcgggccttcagcgatctgca
caaccagctgcacatcacgccggccacggcctaccagagcttcgaggacgtgatggacgaggtgttccgggacggcgtca
actggggccgcatcgtggggctgttcgccttcggcggggcgctgtgcgtggagtgcgtggacaaggagatgagtccgctg
gtgggcaggatcgtcgagtggatgacgctctacctggacaaccacattcagccctggatccagaaccagggaggctggcg
ttcagacatttga
>gnl|bcl2dbcds|G3P7B4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gasterosteus aculeatus GN=BCL2L1 (length=663 residues).
atggcgaacattaacagggagctggtggagttcttcctaagctacaagctgtctcagaagaaccacccaacctctctgtt
gaggccggaggatgccggcggaaggacggagggagacaaggccaactcggcgtccgttcctggacgcgggagcagcgccg
gccagccggggatgtcgtcgccaccgccgccaccgtccggtgacaccgaggccgtaaaggcagctcttcaggactctgcg
aatgagtttgagctgctcttcacgcaagcgttcagtgacctctccttgcagctagacgtcacccccgacacggcctacca
cagcttcaagagcgtgatggacgaggtgttcaaggatggcgtcaactggggccgcgtggtgggcctgtttgccttcggcg
gcgtgctctgcgtggagtgcgtagagaaggacatgaccgagctggtgtcccgcatcgcggactggatgaccacgtacctg
gacgagcacatcagtgcttggatccagagccagggaggatgggactgttttgctgacattttcgggcgggacggcgcggc
agcggcgaggagatctcaggagacgatgagaaggtggctgctcgtcggggtggcgctgctaatgggagtgctcgtcggta
tggtcatggtcaagaagcggtga
>gnl|bcl2dbcds|A0A452ILL8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gopherus agassizii GN=BCL2L1 (length=690 residues).
atgtcgaacactaacagggaattagtgattgactttctctcctacaagctatcgcagaggggatacagctggagtcggtt
cgaaggggaggatgagatcaggactgattctgcagaagaggctgagatggcaagtgtccctaatgggagtccatcctggc
atccgggtgccagccacatagtgaatggggctgctgggcacagtaacagccttgaagcccatgaaagggttccagcaact
ggagtgaggcaggcgctgagagaggcaggagatgagtttgaattgaggtatcggagggctttcagtgacctcacttccca
actccacatcactcctggcacggcataccagagctttgagcaggtagtgaatgaactcttccgggacggagtgaactggg
ggcgcattgtggcttttttctcctttggaggagccctgtgtgtggagagtgtcgacaaggagatgcaggtgttggttgga
cgcatcgtctcatggatgaccacttacctgactgaccacctagatccctggatccaagagaatggcggttgggagcggtt
tgtggatctctatgggaatgacgctgctgccaagagcaggaaaggccaggagcagttcaacaggtggcttctgaccgggg
cgactctggcaggagtgctcctgctgggctctctgctgagccgcaagtaa
>gnl|bcl2dbcds|A0A452ILL8_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Gopherus agassizii GN=BCL2L1 (length=690 residues).
atgtcgaacactaacagggaattagtgattgactttctctcctacaagctatcgcagaggggatacagctggagtcggtt
cgaaggggaggatgagatcaggactgattctgcagaagaggctgagatggcaagtgtccctaatgggagtccatcctggc
atccgggtgccagccacatagtgaatggggctgctgggcacagtaacagccttgaagcccatgaaagggttccagcaact
ggagtgaggcaggcgctgagagaggcaggagatgagtttgaattgaggtatcggagggctttcagtgacctcacttccca
actccacatcactcctggcacggcataccagagctttgagcaggtagtgaatgaactcttccgggacggagtgaactggg
ggcgcattgtggcttttttctcctttggaggagccctgtgtgtggagagtgtcgacaaggagatgcaggtgttggttgga
cgcatcgtctcatggatgaccacttacctgactgaccacctagatccctggatccaagagaatggcggttgggagcggtt
tgtggatctctatgggaatgacgctgctgccaagagcaggaaaggccaggagcagttcaacaggtggcttctgaccgggg
cgactctggcaggagtgctcctgctgggctctctgctgagccgcaagtaa
>gnl|bcl2dbcds|A0A3Q2X557_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Haplochromis burtoni GN=BCL2L1 (length=702 residues).
atgtctcaaaacagagaacttgtgcttttctacataaggtataaactctcccagagaaactatcctctcaaccacatagt
actcaacgagccttcgaacaggactgatgggggggcagcggggttggatgaggaacagcgaatagacacacacgccaatg
ggacttttaatggcacgagtcccgggaccccaccggcatccccgcagcggcggcagcagcagccgccatcaacgacggac
ctcgacgcagtgaaggaggcgctccgggacacggctaacgagttcgagctgcgatacgctcgtgccttcagcgaccttca
cagccaactgcacatcacgccggccacggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtta
actggggccgcatcgtagggcttttcgcgttcggcggggcactgtgtgtcgagtgcgtcgagaaggagatgagccccttg
gtgggcaggatcgtagagtggatgacggtctacctagacaaccacattcagccctggatccagagccaaggaggatggga
gcgcttcgctgaaatcttcgggcaggatgcggcggctgaaagccggaggtctcaggagagtttcaagaagtggctgctgg
tggggatgacggtggtgacaggcgttgtggcgggtgcgcttatcgcgcaaaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q3DUT7_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Hippocampus comes GN=BCL2L1 (length=678 residues).
atgtctcaaaatcgagaactggttttgttttacattaggtacaaactttcccagaaaaactacccgctcaaccacatagg
actcagacaggcattgaacaggactgatggcagggaggaagcctcaggcgaggaggagcagcgggtacagacgcctgcca
atgggacgaccaacggcaccagtcccccggcgtcgccgctacgagaggcggcgagcctggacgcggtgaaggaggccctg
cgggactcggccaatgagtttgagttgcgctactcccacgccttcagcgacctggacaaacagctgcacattacaccggc
cactgcctaccaaagctttgagaacgttgtggatgaggtgttccaggacgacgtcaactggggccgcatcgtggggctct
tcgcgttcggcggcgcgctgtgcgtcgaatgcatggagaaggagatgatccccctggttgacaggatcatcgagtggatg
acggtgtacctggacaaccaccttcagccctggatagagagccaaggaggatggcaacgctttgccgaaatttttggcca
cgacgcggcagcggaggtccgccgctcccaggagagtttcaagaagtggcttttggccggggtgaccttggtgaccgggg
tcgtggtgggctcgctcatcgcccagaagcgcctgtga
>gnl|bcl2dbcds|A0A3Q3DUT7_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Hippocampus comes GN=BCL2L1 (length=678 residues).
atgtctcaaaatcgagaactggttttgttttacattaggtacaaactttcccagaaaaactacccgctcaaccacatagg
actcagacaggcattgaacaggactgatggcagggaggaagcctcaggcgaggaggagcagcgggtacagacgcctgcca
atgggacgaccaacggcaccagtcccccggcgtcgccgctacgagaggcggcgagcctggacgcggtgaaggaggccctg
cgggactcggccaatgagtttgagttgcgctactcccacgccttcagcgacctggacaaacagctgcacattacaccggc
cactgcctaccaaagctttgagaacgttgtggatgaggtgttccaggacgacgtcaactggggccgcatcgtggggctct
tcgcgttcggcggcgcgctgtgcgtcgaatgcatggagaaggagatgatccccctggttgacaggatcatcgagtggatg
acggtgtacctggacaaccaccttcagccctggatagagagccaaggaggatggcaacgctttgccgaaatttttggcca
cgacgcggcagcggaggtccgccgctcccaggagagtttcaagaagtggcttttggccggggtgaccttggtgaccgggg
tcgtggtgggctcgctcatcgcccagaagcgcctgtga
>gnl|bcl2dbcds|A0A3Q3DUT7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Hippocampus comes GN=BCL2L1 (length=678 residues).
atgtctcaaaatcgagaactggttttgttttacattaggtacaaactttcccagaaaaactacccgctcaaccacatagg
actcagacaggcattgaacaggactgatggcagggaggaagcctcaggcgaggaggagcagcgggtacagacgcctgcca
atgggacgaccaacggcaccagtcccccggcgtcgccgctacgagaggcggcgagcctggacgcggtgaaggaggccctg
cgggactcggccaatgagtttgagttgcgctactcccacgccttcagcgacctggacaaacagctgcacattacaccggc
cactgcctaccaaagctttgagaacgttgtggatgaggtgttccaggacgacgtcaactggggccgcatcgtggggctct
tcgcgttcggcggcgcgctgtgcgtcgaatgcatggagaaggagatgatccccctggttgacaggatcatcgagtggatg
acggtgtacctggacaaccaccttcagccctggatagagagccaaggaggatggcaacgctttgccgaaatttttggcca
cgacgcggcagcggaggtccgccgctcccaggagagtttcaagaagtggcttttggccggggtgaccttggtgaccgggg
tcgtggtgggctcgctcatcgcccagaagcgcctgtga
>gnl|bcl2dbcds|A0A287CZ07_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2L1 (length=675 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagaacaggactgaagccccagaagggactgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcatctggccgacagccccgcgataaatggagccactggtcacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcattgagggaggcaggcgacgagtttgaactgtggtactggcgggcattcagtga
cctgacgtcccagctccacatcaccctggggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcacattgtggcctttctctcctttggcggggcactgtgcatggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatgccttggatccaagagaacggcggctgggacacttttgtggaactctacag
gaataatgcggcagcagagagccggaagggccaggagcgcttcaaccgttggttcctgacgggcatgactgtggccggtg
tggttctgctgggctcacttttcagtcggaaatga
>gnl|bcl2dbcds|I3MUP5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagaacaggactgaagccccagaagggactgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcatctggccgacagccccgcggtaaatggagccactggtcacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcattgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacgtcccagctccacatcaccccggggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaataatgcagcagcagagagccggaagggccaggagcgcttcaaccgttggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcgcttttcagtcggaaatga
>gnl|bcl2dbcds|I3MUP5_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagaacaggactgaagccccagaagggactgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcatctggccgacagccccgcggtaaatggagccactggtcacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcattgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacgtcccagctccacatcaccccggggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaataatgcagcagcagagagccggaagggccaggagcgcttcaaccgttggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcgcttttcagtcggaaatga
>gnl|bcl2dbcds|I3MUP5_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagaacaggactgaagccccagaagggactgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcatctggccgacagccccgcggtaaatggagccactggtcacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcattgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacgtcccagctccacatcaccccggggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaataatgcagcagcagagagccggaagggccaggagcgcttcaaccgttggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcgcttttcagtcggaaatga
>gnl|bcl2dbcds|A0A3Q3B3X5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Kryptolebias marmoratus GN=BCL2L1 (length=699 residues).
atgtctcaaaacaaagaactggtgcttttctatattatgtataaactgtcacagagaaactatcctgtcaatcacataat
actcagtgatcctccgaatagaactgatgcaggggatgcagggttggaggacgcagagatgacagagacacacgccaatg
ggacttttaacgggactagtcctgggaccccgccggcgtccccactgaggcagcaaccgctgccgacgacggcgaacatg
gacaaggtgaaggaagctctccgggacacggcaaacgagttcgagctgcggtacgcccgcgctttcagcgacctgcacag
ccagctgcacatcacgcccggcaccgtctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaact
ggggccgcattgtggggctctttgcattcggcggagcgctgtgcgtcgagtgcgtcgagaaggagatgagtcacctggtg
gccaggattgtggagtggatgaccgtctacctggacaaccacattcagccttggattcagagtcaagggggatgggagcg
ctttgctgaaatcttcggcgacaacgcggcggctgaaagcagaatctctcaggagggtttaaagaagtggctgctggtgg
ggatgacggtggtgaccgcggtggtggcgggttcgctcttcgcccagaagcgcctgtga
>gnl|bcl2dbcds|A0A3Q3BEB7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Kryptolebias marmoratus GN=BCL2L1 (length=657 residues).
atgtcacacagcaacagagatctggtgcagttctacataagctataagttgtctcagaggaactgttcgaagtctctgct
gatgccggaggttgccggtgaaaggaccgagaaggccagctcggctcccagtaacggcttgctggtcaacagtagggacg
gccagtcggggaagaagatctggccccgccgcagcgacatagaggccgtaaaatcagctctgaaggactctgcggatgag
tttgagcgtctctacacgcaaagtttcagccacctgtccctgcagctcgacatcagccccgacacggtctaccacagctt
caagagcgtgctggacgagctgttcaaggacggggtgaactggggccgcgtggtgggcctgtttgccttcggcggcgtgc
tgtgcgttcagtgcgtcgagagggacatgagtgagctggtctcccgcattgcagactggatgaccgtttacctggatgag
cagatcggtccgtggatcgacagccagggaggatgggacagcttcgctgagatgtacgggcgagatgccgctgcagaagc
gaggaggtttcaggagtccctgaagaaatggctgctagctggagcggcgctgctggctgggctgcttctcggcgtgctcg
tggctaagaagcgttaa
>gnl|bcl2dbcds|A0A3Q3FUB6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Labrus bergylta GN=BCL2L1 (length=666 residues).
atgtcatacagtaacagagagctggtggagttcttcataagctacaaactgtctcagaggaactatccaacctatgtgct
gaggtcagaggatgctggtgaaaggactgagggagacatggaaaactctgctgccagtaatggctttttggtcaacagca
ggaaccgggccggccagtcagtgatgtcatcatccccacacaccgacatagaggctgtaaaggcagctcttctggactct
gcagatgagtttgagcttctctttacgcaggcctttagtgacctttcctcgcagcttgacattactcccaacacagccta
tcacagctttaagagtgtgatggacgaggttttcaaggatggagtcaactgggggcgtatagtaggcctgtttgcctttg
gcggtgtactgtgtgtggaatgcgtccagaaggatatgggtgaactggtttcccgcatcgcaggctggatgactacgtac
ctggatgagcacattagtgcatggatcgagagccagggaggatgggactgctttgttgaaattttcggacggggcgctgt
tggagaagtgaggagatctcgggaaactctcaccagatggctgctagttggaatggcgctgctaatgggagtcgtggttg
gtgtttacatcgctaagaaacattaa
>gnl|bcl2dbcds|A0A3Q3G2E1_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Labrus bergylta GN=BCL2L1 (length=705 residues).
atgtctcaaaacagagaactagtggttttctacataacctataaattctctcagagaaattatcctcttaatcacatgga
actcttagagcctccaaacaggactgatggggcgggggcagggtcgggtgaggaacagcaggtagcgacgcacgccaacg
ggacttttaacggcacgagtcctggaacccccccagcgtccccacaccggcagcagcaacaacggttaccagcaacgacg
aatctggacgcggtgaaggaggccctccgggactcggccaacgagtttgagctgcgatatgccagcgccttcagcgatct
gcacaaccagctgcacatcacgccggccacaacccaccagagctttgagaacgtgatggacgaggtgttccgggacggag
tcaactggggccgcatcgtggggctctttgctttcggcggggcgctgtgtgtcgagtgcgtggagaaggagatgagtccc
ctcgttggcaggatcatagagtggatgactgtctacctggacaaccgaattcaaccttggatcgagagccaaggaggatg
ggagcgcttctctgaaatctttgggcaggatgcggcgggagagatcaggaggtctcaggagagtttcaaaaagtggctgc
tggcggggatgacgctggtgaccggggtcgtggtgggctcactcatcgcccagaaacgcctgtag
>gnl|bcl2dbcds|A0A3Q3G2E1_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Labrus bergylta GN=BCL2L1 (length=705 residues).
atgtctcaaaacagagaactagtggttttctacataacctataaattctctcagagaaattatcctcttaatcacatgga
actcttagagcctccaaacaggactgatggggcgggggcagggtcgggtgaggaacagcaggtagcgacgcacgccaacg
ggacttttaacggcacgagtcctggaacccccccagcgtccccacaccggcagcagcaacaacggttaccagcaacgacg
aatctggacgcggtgaaggaggccctccgggactcggccaacgagtttgagctgcgatatgccagcgccttcagcgatct
gcacaaccagctgcacatcacgccggccacaacccaccagagctttgagaacgtgatggacgaggtgttccgggacggag
tcaactggggccgcatcgtggggctctttgctttcggcggggcgctgtgtgtcgagtgcgtggagaaggagatgagtccc
ctcgttggcaggatcatagagtggatgactgtctacctggacaaccgaattcaaccttggatcgagagccaaggaggatg
ggagcgcttctctgaaatctttgggcaggatgcggcgggagagatcaggaggtctcaggagagtttcaaaaagtggctgc
tggcggggatgacgctggtgaccggggtcgtggtgggctcactcatcgcccagaaacgcctgtag
>gnl|bcl2dbcds|A0A3Q3G2E1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Labrus bergylta GN=BCL2L1 (length=705 residues).
atgtctcaaaacagagaactagtggttttctacataacctataaattctctcagagaaattatcctcttaatcacatgga
actcttagagcctccaaacaggactgatggggcgggggcagggtcgggtgaggaacagcaggtagcgacgcacgccaacg
ggacttttaacggcacgagtcctggaacccccccagcgtccccacaccggcagcagcaacaacggttaccagcaacgacg
aatctggacgcggtgaaggaggccctccgggactcggccaacgagtttgagctgcgatatgccagcgccttcagcgatct
gcacaaccagctgcacatcacgccggccacaacccaccagagctttgagaacgtgatggacgaggtgttccgggacggag
tcaactggggccgcatcgtggggctctttgctttcggcggggcgctgtgtgtcgagtgcgtggagaaggagatgagtccc
ctcgttggcaggatcatagagtggatgactgtctacctggacaaccgaattcaaccttggatcgagagccaaggaggatg
ggagcgcttctctgaaatctttgggcaggatgcggcgggagagatcaggaggtctcaggagagtttcaaaaagtggctgc
tggcggggatgacgctggtgaccggggtcgtggtgggctcactcatcgcccagaaacgcctgtag
>gnl|bcl2dbcds|H3ANS8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Latimeria chalumnae GN=BCL2L1 (length=720 residues).
aaaatgtccttcaacaggttgctggtggtggaccatatatcccagaagctgatgcagcggggataccagtggagggaggt
tggtgagcaggaccacggtggtggaggagaccgcgcgagggaagcacagactcccgaggagggggccattccaggcatgg
acccacccaacggcagccaccctcatgcaggactcaatggtgcggttaacgggttgccggctggcagcagcagccgcctg
gaagcccaggcggtgtcggggcccgaagccgtgaaacggacattgcgagaggccggggaagagtttgagctgaggtatag
ccgagcattcagtgacctctcttcccagctccacatcacccccggcacagcctaccagagctttgaacaggtggtgaacg
aactcttccgggacggagtgaactgggggcgcgtggtggctttctttgcctttggaggggcgttgtgtgtggagagtatg
gacaaggagatgtcttcactagtagagcggatcgctgagtggatgacgacttacctagatgataacttaaacccttggat
tcaggaacaaggaggatgggcaaccataatacacattgacggggttgacgctatgcagcgctcaaacaccaggagtgaaa
aattgggttttgttgggttttttttttcctttcttctgcgtggggtggaaagaaacctcaaactctttttgcgcaaatga
>gnl|bcl2dbcds|E2IV76_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Lemur catta GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tatcgatgcagaagagaacaggactgaggccccagaagggactgaatcggagatggaaacccccagtgccattaatggca
acccatcctggcacctggcagacagccctccagcgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccctatggcagcagtgaagcaagcactgaaggaggcgggcgatgagtttgaacttcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccctagggacagcatatcaaagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggccctatgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggctggcgtggttctgctgggctcgcttttcagtcggaaatga
>gnl|bcl2dbcds|W5MG74_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Lepisosteus oculatus GN=BCL2L1 (length=669 residues).
aagatgtcatacagcaacagagacctcgtcgtctactacatcaactataaactctcgcagaagaactactcctgggacca
gttcagcctggagggcaggaccggaggcgctgaggcggtgggttcggggagcccgaacgcagaggagcgtacgaacggcg
cggccaatggcgggggggggcccgtgtcgcgccagcccccccaggggatcgaggcggtgcagggggcgctgcgcgactcc
gccaacgagtttgagctccgctacggccgggcgttcagcgacctgtcctcccagctccacatcacgcccgccaccgccta
ccagagcttcgagcacgtcatggacgaggtcttccgggacggggtgaactgggggcgcatcgtggggctcttcgctttcg
ggggtgcgctgtgcgtggagtgcgtggagaaggagatgagcaacctggtgagccgcatagccgagtggatgaccgtctac
ctggacaacaacattcagccctggatccagagtcagggaggatgggacaggtttgcggagatctttggcaaggatgcggc
tgcggagtaccggagatcacaggagagcttcaagaagtggctgctggcgggcatgactctggttacggggctggtggtgg
gctcctacatcgccaagaaacgcttatag
>gnl|bcl2dbcds|A0A218USB3_BCL2L1-04 BCL2-like 1 gene OS=[Eukaryota] Lonchura striata domestica GN=BCL2L1 (length=693 residues).
atgtacagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagaaaggatacagctggagtcagct
ggaagaggaggatgagaacaggactgactttgcaggggaggaggacgagatggacggggtcctcaacgggagcccctcct
ggcacgcggccaccagccacatagtgaatggagccactgtgcaccagagcagcctcgaagtccatgagatccgtcgagca
gccgatgtgaggcaggcgctgagagaggcaggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcacttc
ccagctccacatcactcccagcacagcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgttaaggagatgagggtattggtg
aaacgcatcgtgtcttggatgaccacgtacttgaccgaccacttggatccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacgatgctgctgccgagatgagaaaaggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A218USB3_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Lonchura striata domestica GN=BCL2L1 (length=723 residues).
atgtacagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagaaaggatacagctggagtcagct
ggaagaggaggatgagaacaggactgactttgcaggggaggaggacgagatggacggggtcctcaacgggagcccctcct
ggcacgcggccaccagccacatagtgaatggagccactgtgcaccagagcagcctcgaagtccatgagatccgtcgagca
gccgatgtgaggcaggcgctgagagaggcaggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcacttc
ccagctccacatcactcccagcacagcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgttaaggagatgagggtattggtg
aaacgcatcgtgtcttggatgaccacgtacttgaccgaccacttggatccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacgatgctgctgccgagatgagaaaaggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggccggagtgcttctgctgagcacgaggattagcattagcccattgaacgcttcggtttgcaggtggagg
tga
>gnl|bcl2dbcds|A0A218USB3_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Lonchura striata domestica GN=BCL2L1 (length=693 residues).
atgtacagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagaaaggatacagctggagtcagct
ggaagaggaggatgagaacaggactgactttgcaggggaggaggacgagatggacggggtcctcaacgggagcccctcct
ggcacgcggccaccagccacatagtgaatggagccactgtgcaccagagcagcctcgaagtccatgagatccgtcgagca
gccgatgtgaggcaggcgctgagagaggcaggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcacttc
ccagctccacatcactcccagcacagcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgttaaggagatgagggtattggtg
aaacgcatcgtgtcttggatgaccacgtacttgaccgaccacttggatccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacgatgctgctgccgagatgagaaaaggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A218USB3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Lonchura striata domestica GN=BCL2L1 (length=747 residues).
atgtacagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagaaaggatacagctggagtcagct
ggaagaggaggatgagaacaggactgactttgcaggggaggaggacgagatggacggggtcctcaacgggagcccctcct
ggcacgcggccaccagccacatagtgaatggagccactgtgcaccagagcagcctcgaagtccatgagatccgtcgagca
gccgatgtgaggcaggcgctgagagaggcaggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcacttc
ccagctccacatcactcccagcacagcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgttaaggagatgagggtattggtg
aaacgcatcgtgtcttggatgaccacgtacttgaccgaccacttggatccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacgatgctgctgccgagatgagaaaaggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggccggagtgcttctgctgagcacggactcgtgctgctcatgtcggacccgctcagaccccgcatgggga
gcacgaggattagcattagcccattga
>gnl|bcl2dbcds|Q4U2V6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Lonchura striata GN=BCL2L1 (length=693 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagaaaggatacagctggagtcagct
ggaagaggaggatgagaacaggactgactttgcaggggaggaggacgagatggacggggtcctcaacgggagcccctcct
ggcacgcggccaccagccacatagtgaatggagccaccgtgcaccagagcagcctcgaagtccatgagatccgtcgagca
gccgatgtgaggcaggcgctgagagaggcaggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcacttc
ccagctccacatcactcccagcacagcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgttaaggagatgagggtattggtg
aaacgcatcgtgtcttggatgaccacgtacttgaccgaccacttagatccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacgatgctgctgccgagatgagaaaaggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|G3SPN0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Loxodonta africana GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagttggagtcagtt
tagtgatgtggaggagaataggactggggcctcggaaggcactgaatccgagatggagatccccagtgccatcaatggca
acccatcccggcacctggcagacagccctgcggtgaatggagctactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcagtgaagcaagctctgagggaggcaggcgatgagttcgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggctacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggtaaggaccacgccccttttgtgcttcagtacctcagtgaaggaagacatagcctatgtgttcattcaggtcaaaa
cctatgcaagtgggaagttagtccagtgtttcctcaccctgacacaatggttcaccacccaa
>gnl|bcl2dbcds|A0A2K5VPG2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5VPG2_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|I7GKS6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L1 (length=447 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctggcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtc
gcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcgg
atcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgt
ggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatga
ctgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|Q2PFS6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L1 (length=570 residues).
atggagacccccagtgccatcaatggcaacccatcctggcacctggtggacagccccgcggtgaatggagccactggcca
cagcagcagtttggatgcccgggaggtgatccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttg
aactgcggtaccggcgggcgttcagtgacctgacatcccagctccacatcaccccagggacagcatatcagagctttgaa
caagtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtg
cgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacc
tagagccttggatccaggagaacggcggctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccga
aagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcag
tcggaaatga
>gnl|bcl2dbcds|A0A2K5YR37_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5YR37_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A3Q3MX20_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mastacembelus armatus GN=BCL2L1 (length=699 residues).
atgtctcaaaacagggaactggtggttttctacataaaatataaactctcccagagaaactatcctctcatctacataga
actcaatgagcaacagaacaggactgatgggggagaggctgagtcaggtgaggaacagcggatagcaacgcatgccaacg
ggacttttaatggcacaagtcctgggacccccccagcgtccccgctgcgacaagaacatttgcagtccacggcaagcctg
gatgcagtgaaagaggccctccgggactcagccaacgagtttgagctacgatacgcccgtgctttcagcgatctgcacaa
ccagctgcatatcacgccagccacggcctaccaaagcttcgagagtgtgatggatgaagtgttccgggacggtgtcaact
ggggtcgcatcatagggctttttgcattcggcggggctctgtgtgtcgagtgtgtggagaaggagatgagtccactggtg
ggcaggattgtggagtggatgaccctctacctggacaaccacattgagccctggatccaaagccagggaggatgggagca
ctttgctgaaatctttgggcaggatgcagcagcagagagcaggaggtcccaagagaatttcaagaagtggctgctggcag
ggatgacgctggtgactggggtcgtggtgggttcacttattgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q3NFM4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mastacembelus armatus GN=BCL2L1 (length=666 residues).
atgtcgtacagtaacagagagctggtggagttctttattagctacaagctgtctcagaagaactacccgacctctctgct
gaggccagaagatgctggtggaaggacagagggagacatgaccggtgcagctgccaccaacggcttgctggtcaacagca
ggtatgtcagcggccggccggggatgtcatcatccccacatggaggcgtagaggctgtaaaggcagctcttagggactcc
gctgaagagtttgaactgctcttcactcaggcgtttagtgacctttcctcacagcttgacatcactcctgacacagctta
ccacagctttaaaagcgtgatggatgaggtgttcaaggatggagtcaactggggacgcatagtgggcctgtttgctttcg
gtggtgtactgtgtgtggaatgcattgagaagaacatgagtgcgctggtgtcccgcatcgcagattggatgaccatgtat
ctggatgagcacatcagtccgtggatcgagagccaaggaggctgggactgctttgctgagatttttgggcgagatgcagc
tgcagaagcaaggagatcacaggaaaccctgaggaggtggctgctagttggagtggcgctgctaacgggagtgctgatag
gtgtgctcatcgctaagaaacagtga
>gnl|bcl2dbcds|A0A3Q3NFM4_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Mastacembelus armatus GN=BCL2L1 (length=666 residues).
atgtcgtacagtaacagagagctggtggagttctttattagctacaagctgtctcagaagaactacccgacctctctgct
gaggccagaagatgctggtggaaggacagagggagacatgaccggtgcagctgccaccaacggcttgctggtcaacagca
ggtatgtcagcggccggccggggatgtcatcatccccacatggaggcgtagaggctgtaaaggcagctcttagggactcc
gctgaagagtttgaactgctcttcactcaggcgtttagtgacctttcctcacagcttgacatcactcctgacacagctta
ccacagctttaaaagcgtgatggatgaggtgttcaaggatggagtcaactggggacgcatagtgggcctgtttgctttcg
gtggtgtactgtgtgtggaatgcattgagaagaacatgagtgcgctggtgtcccgcatcgcagattggatgaccatgtat
ctggatgagcacatcagtccgtggatcgagagccaaggaggctgggactgctttgctgagatttttgggcgagatgcagc
tgcagaagcaaggagatcacaggaaaccctgaggaggtggctgctagttggagtggcgctgctaacgggagtgctgatag
gtgtgctcatcgctaagaaacagtga
>gnl|bcl2dbcds|A0A3P9D632_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Maylandia zebra GN=BCL2L1 (length=702 residues).
atgtctcaaaacagagaacttgtgcttttctacataaggtataaactctcccagagaaactatcctctcaaccacatagt
actcaacgagccttcgaacaggactgatgggggggcagcggggttggatgaggaacagcgaatagacacacacgccaatg
ggacttttaatggcacgagtcccgggaccccaccggcatccccgcagcggcggcagcagcagccgccatcaacgacggac
ctcgacgcagtgaaggaggcgctccgggacacggccaatgagttcgagctgcgatacgctcgtgccttcagcgaccttca
cagccagctgcacatcacgccggccacggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtta
actggggccgcatcgtagggcttttcgcgttcggcggggcactgtgtgtcgagtgcgtcgagaaggagatgagccccttg
gtgggcaggatcgtagagtggatgacggtctacctagacaaccacattcagccctggatccagagccaaggaggatggga
gcgcttcgctgaaatcttcgggcaggatgcggcggctgaaagccggaggtctcaggagagtttcaagaagtggctgctgg
tggggatgacggtggtgacaggcgttgtggcgggtgcgcttatcgcgcaaaaacgcctgtga
>gnl|bcl2dbcds|A0A3P9D632_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Maylandia zebra GN=BCL2L1 (length=702 residues).
atgtctcaaaacagagaacttgtgcttttctacataaggtataaactctcccagagaaactatcctctcaaccacatagt
actcaacgagccttcgaacaggactgatgggggggcagcggggttggatgaggaacagcgaatagacacacacgccaatg
ggacttttaatggcacgagtcccgggaccccaccggcatccccgcagcggcggcagcagcagccgccatcaacgacggac
ctcgacgcagtgaaggaggcgctccgggacacggccaatgagttcgagctgcgatacgctcgtgccttcagcgaccttca
cagccagctgcacatcacgccggccacggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtta
actggggccgcatcgtagggcttttcgcgttcggcggggcactgtgtgtcgagtgcgtcgagaaggagatgagccccttg
gtgggcaggatcgtagagtggatgacggtctacctagacaaccacattcagccctggatccagagccaaggaggatggga
gcgcttcgctgaaatcttcgggcaggatgcggcggctgaaagccggaggtctcaggagagtttcaagaagtggctgctgg
tggggatgacggtggtgacaggcgttgtggcgggtgcgcttatcgcgcaaaaacgcctgtga
>gnl|bcl2dbcds|G1N5N5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Meleagris gallopavo GN=BCL2L1 (length=690 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcgcagaaggggcactgctggagcgagct
ggaggaagaggatgagaacaggactgacactgcagcagaggcagagatggacagcgtcctcaatgggagcccatcctggc
acccgcctgccggccacgtagtgaatggagccgccgtgcacaggagcagcctggaagttcatgaaattgttcgagcatct
gacgtgaggcagacgctgagagatgcaggggatgagtttgagctgaggtaccggagggctttcagcgatctcacctccca
gctccacatcacccctggcacggcgtaccagagctttgagcaggtagtgaacgaactcttccatgatggtgtgaactggg
ggcgcatcgtggctttcttctccttcggaggggctttgtgcgtggagagcgtggacaaggagatgcgggtactggtggga
cgcattgtgtcttggatgaccacgtacttgaccgaccatctagacccctggatccaggagaatggcggctgggagcgctt
tgtggacctgtatgggaataatgctgctgccgagctgaggaagggccaggagaccttcaacaaatggctcctgaccgggg
cgaccgtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A1U7QU73_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mesocricetus auratus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctagtggttgactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaacaggactgaggccccagaaggagccgaatcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcacgggaggtg
atccccatggcagccgtgaagcaagcgctgagagaggccggcgatgagtttgaactgcggtaccggcgggcattcagtga
tctgacatcccagcttcatataaccccgggaactgcatatcaaagctttgagcaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggtggagccctctgtgtggaaagcgtagacaaggagatgcag
gtgttggtgagtcggattgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggacaacggcgg
ctgggacactttcgtggaactctatgggaacaatgcagcagctgagagccggaaaggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctctctcttcagtcggaagtga
>gnl|bcl2dbcds|A0A3Q3WIW8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mola mola GN=BCL2L1 (length=693 residues).
atgtctgtaaacagagaactggtggcttactacataaactataaactctcccatagaggctgtcctctcaaccacatggg
actcatagagcctcccaacaggactgagggggggcaggcagtgtcagatgaggaacagcgggtagcgacacacgccaatg
ggacttttaacggtacgagtcccgggacccctccaaggtccccgctgcggctgcaaccgtcgacaacaagtctggacgca
gtaaaagatgccctgcgggactctgccaacgagttcgagctgcggtatgcccgcgccttcagtgacctgcacaaccagct
ccacatcacaccggccaccgcctaccaaagctttgagaacgtgatggacgaggtgttcagggacggtgtcaactggggac
gcatagtcggactcttcgctttcggcggtgcactgtgcgtagagtgcgttgagaaggagatgagtccactggtgggcagg
atcatcgagtggatgacggtctatctggacaaccaaatccagccctggatcgagagccagggaggatggcaacgctttgc
cgaaatcttcggacaggacgcggctgctgagagcaggaggtctcaggagagcttcaagaagtggctgctggccgggatga
ccctggtgaccggagtcgtggttggctcgctcattgtccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q3X5M5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mola mola GN=BCL2L1 (length=657 residues).
atgtcgcacagtaacagagagctggtggagttctttataagctacaaactgactcaaaagaactacccaacctctctgtt
aaggccagaagataccggtgggaggactgaaggagacaaggccagctctgctgccagaaatggcttgctggtcaacagca
gtagtaggggtggactgtctccttccacaggtgctgacatggaggctgttaagtcggcgcttagggactcagccaatgag
tttgagcagctcttcacacaagcgttcagtgacctctcctcgcagcttgacatcacccctgacacagcctatcacagttt
taagagcgtgatggacgaggtgttcaaggacggggtcaactggggacgtatagtgggactgtttgcctttggaggtgttc
tatgtgtggaatgtgctgagaaggatacaggtgagcttgtttgccgcattgcagactggatgaccacttacctggatgag
catattaatccgtggatccagagtcaaggtggatggggctgctttgctgaggtttttgggcacaacgccgctgcagaagc
aaggagatctcaggagactctgaatagatggctcctagtcggggtggcgctgctaatgggagttatggtcggtgtgttca
ttgctaagaaacagtaa
>gnl|bcl2dbcds|F6WA14_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Monodelphis domestica GN=BCL2L1 (length=684 residues).
atgtcgcacagtaaccgggagctggtgattgactttctttcttacaagctctcacagaaaggatacaattggagtcagtt
tgaagatgagaacaggactgaggttctagaaggggcagagatacctagtactgtgaatggcagtccctcttggcaccctg
ctgacagccgtgctgtgagtggggccacagggcacagcagcagcctggatgcccatgagacaataccagtggctgctgtg
aagcaagctttgagggaggcaggagatgaatttgaacttcggtacaggcgggcattcagtgacctgacatcccagctcca
catcacgccaggaacagcttatcagagctttgagcaggtagtgaatgaactcttccgggatggggtgaactggggccgaa
ttgtggcattcttctccttcggaggggcattgtgtgtggaaagcgtggataaggagatggaagtcttggtaggacgcatc
acctcctggatggccacttacttggatgaccacctagacccttggatccaagaaaatggcggctgggacacctttgtgga
actttatgggaatgatgcagctgcagagagccggaagggccaggaacgcttcaaccgatggctgctgactggcatgacag
tggccggtgtagtcctgctggggtccctattcagccggaagtga
>gnl|bcl2dbcds|A0A3Q3IVF5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Monopterus albus GN=BCL2L1 (length=672 residues).
atgtctcaaaacaaagaactggtggttttctacataacatataaactctcccagaaaaactatcctctcagccacttggg
actaaatgagtctccaaacaggactgatggagaggaggcaacgcacgccaatgggacttttaacggcaccagtcccggga
cccccccagcatccccgctaaggcaacaacagttgccatcaacggcaaacctggatgcggtgaaagaggccctccgggac
tcagccaatgagtttgagctgcgatatgcccgtgctttcagtgatctgcaccaccagctgcatatcacaccagccacggc
ctaccaaagctttgagagcgtgatggatgaagtgttccgggacggcgtcaactggggccgcatcatagggctttttgcat
ttggcggggcgttgtgtgtcgagtgtgtggagaaagagatgagtccgctggtgggtaggattgtagagtggatgacagtc
tacctggataaccacattcagccctggatccaaggccaaggaggatgggagcgctttgctgaactctttgggcaggatgc
ggcggcagagaacaggaggtctcaggagagcttcaagaagtggctgctggcggggatgaccctggtgaccggcgtcgtgg
tgggctcactcatcatccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q3J5K3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Monopterus albus GN=BCL2L1 (length=609 residues).
atgtcgtacagtcacagagagctggtggagttctatataagctacaagttgtctcagagaaactactcaacctctctgct
gaggccggaaaacgctggtggaaggactgagggagacaggaccaacccagctaccactaacggccttggcatagaggctg
taaaggctgctcttagggactctgctgatgagtttgaactgcgcttcacacaagcatttagtgacctttcctcgcagctt
gtcatcactcctgacacagcctacaacagctttaaaagcgtgatggatgaagtgttcaaagatggagtcaactggggacg
tattgtgggcttgtttgcttttggtggtgcactgtgtgtggaatgcgtcgagaagaatatgagtgagctggtgtcccgca
tcgcagactggatgaccatgtacctggatgagcacatcagtccgtggatccagaaccaaggaggctgggactgctttgca
gagatttttgggcgagataacgctgcagaagtgcgaagatctcaggagaccctgaggagatggctgctagttggagtggt
gctgctaacaggagtgctggttggtgtgcttgtcgctaagaaattgtga
>gnl|bcl2dbcds|O35843_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mus musculus GN=BCL2L1 (length=708 residues).
atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgttgaagagaataggactgaggccccagaagaaactgaagcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagcccggccgtgaatggagccactggccacagcagcagtttggatgcgcgggaggtg
attcccatggcagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcggtaccggagagcgttcagtga
tctaacatcccagcttcacataaccccagggaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctatctgaatgaccacctagagccttggatccaggagaacggcgg
ctggggtgtgagtggaggtacacccctcagatctgtcttcagaaggcttgttcaagtgccaggagtggcggagcacgttt
gtgatcccagcctttgggaggtggaaacagaaggatcggaagttcaaggccctcctcagctattatag
>gnl|bcl2dbcds|Q64373_BCL2L1-09 BCL2-like 1 gene OS=[Eukaryota] Mus musculus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaataggactgaggccccagaagaaactgaagcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagcccggccgtgaatggagccactggccacagcagcagtttggatgcgcgggaggtg
attcccatggcagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcggtaccggagagcgttcagtga
tctaacatcccagcttcacataaccccagggaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggatctctacgggaacaatgcagcagccgagagccggaaaggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcactcttcagtcggaagtga
>gnl|bcl2dbcds|Q64373_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mus musculus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaataggactgaggccccagaagaaactgaagcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagcccggccgtgaatggagccactggccacagcagcagtttggatgcgcgggaggtg
attcccatggcagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcggtaccggagagcgttcagtga
tctaacatcccagcttcacataaccccagggaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggatctctacgggaacaatgcagcagccgagagccggaaaggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcactcttcagtcggaagtga
>gnl|bcl2dbcds|M3Z2H9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mustela putorius furo GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgcagaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtaaagcaagcgctgagggaggctggggatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatctcagcttcacatcaccccagggacagcgtatcagagctttgagcaggtggtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggctctgtgtgtggagagcgtagacaaggagatgcag
gcattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggacactttcgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|G1P9D2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Myotis lucifugus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggaactggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccctgcggtgaatggagccactggccacagcagtagcttggatgcccgggaggtg
attcccatggcagcggtgaagcaagcgctgagggaggcaggcgacgagtttgaactgaggtaccggcgggcgttcagcga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgagcaagtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctcgttcggtggggcattgtgcgtggaaagtgtggacaaggagatgcag
gtattggtgagtcggattgcaacgtggatggccacttacctgaatgaccacctagagccttggatccaggagaacggagg
ctgggacacttttgtggaactctacgggaacaacgcagcagccgagagccggaagggccaggaacgcttcaatcgctggt
tcctgacgggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|R4JQR8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mytilus galloprovincialis GN=BCL2L1 (length=558 residues).
atgaaccagtttagttcaagatatttagtggcagactttattaatgaccgacttcgaaaacatggaatgcgatgggacaa
ctgtcctacgttagacttgccaccatcacaaattcagcttaaattacgttcacttggagatgaattccaagaaagatttc
agactcagtttgacgatatggtcaatcagttacacataactgaggctactgcatatccaacgtttcaaagagttgttcag
gaattatttattgatggaaatattaactggggaaggattgtggctcttttcggttttggtgggtctttgtcagtgaaatg
tgtacaaagaggaatgccacaacttgtggattcaattgttgactgggtatctacctatttgtgtaatagtttagagcaat
ggattacagataacggtggttggcaaggatttgtggaagcctataaccaaggacagaatcataatgacagtccgtgggat
gtgaaaggacttgttaaatacggagcaataggtgtaataggcgcaatggcgttaagtgcttttctacatagaacgtga
>gnl|bcl2dbcds|A0A3Q4N4B5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Neolamprologus brichardi GN=BCL2L1 (length=702 residues).
atgtctcaaaacagagaacttgtgcttttctacataaggtataaactctcccagagaaactatcctctcaaccacatagt
actcaacgagccttcgaacaggactgatgggggggcagcggggttggatgaggaacagcgaatagacacacacgccaatg
ggacttttaatggcacgagtcccgggaccccaccggcatccccgcagcggcggcagcagcagccgccatcaacgacggac
ctcgacgcagtgaaggaggcgctccgggacacggccaatgagttcgagctgcgatacgctcgtgccttcagcgaccttca
cagccagctgcacatcacgccggccacggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtta
actggggccgcatcgtagggctttttgcgttcggtggggcactgtgtgtcgagtgcgtcgagaaggagatgagccccttg
gtgggcaggatcgtagagtggatgacggtctacctagacaaccacattcagccctggatccagagccaaggaggatggga
gcacttcgctgaaatctttgggcaggatgcggcggctgaaagccggaggtctcaggagagtttcaagaagtggctgctgg
tggggatgacggtggtgacaggcgtcgtggcgggtgcgcttatcgcgcaaaaacgcctgtga
>gnl|bcl2dbcds|G1RER8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L1 (length=651 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggc
>gnl|bcl2dbcds|C3VIT1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Odontesthes bonariensis GN=BCL2L1 (length=708 residues).
atgtctcaaaacagagaactggtggttttctacataaagtataaactctcccagagaaactatcctctcaaccacatagt
gctcaatgagcctccgaacaggactggtgccggggacgggggtctgggcgaggagcagagcacagagacgcacgccaacg
ggacttttaccgggaccagtcccgggaccccgccggtgtcccctctgaggcagcaaccgttgccgtcgacgacgacgacg
acgcgcctggacgcggtgaaagaggccctccgagacacggccaacgagttcgagctgcggtacgcccgcgccttcagcga
cctccacagccagctgcacatcacgccggccacggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacg
gcgtcaactggggtcgcatcgtggggcttttcgctttcggcggggcgctgtgcgtggagtgcgtggagagggagatgagc
cccttggtgggcaggatcgtggagtggatgacggtctacctggacaaccacattcagccctggatccagagccagggagg
atgggaacgcttcgctgagatcttcgggcaggacgcggcggccgaaagcaggaggtctcaggagagcttcaagaagtggc
tgctggtggggatgaccgtggtgaccggggtggtggtgggctcgctgttcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A286MU87_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus mykiss GN=BCL2L1 (length=651 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctatagactgtcccagaggaattattcatgttgtcaatt
ggggctggagggtgcaagtggacggactgacggagatgaggccattgcaaatgggtctgtggggaactaccggaacagca
gaagcaatttggcgaagccctcatctccacaggggggcatggagccagtgaaagcagcactacgggactcagtggatgag
tttgagctacgctacacccgtgccttcagtgacctctcctcccagctccacatcacccctgccacagcctaccacagctt
tgagagtgtgatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggtctgtttgctttcggcggggcct
tgtgtgttgagtgtgttgagaaggatatgagcccgctggtggcgcgcatcgcagattggatgaccacctatctggacaac
catatccagccctggatccagagccaaggcggatgggcagagatctttggcagagatgctgctgcagacgttcgacggtc
tcaggagagcataattaaatggctgctagttggggtgattctgctttcaggagtgctggtcggcactctcatcatgaaga
aacgccagtga
>gnl|bcl2dbcds|I3IZK7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oreochromis niloticus GN=BCL2L1 (length=705 residues).
tacaaaatgtctcaaaacagagaactggtgcttttctacataaggtataaactctcccagagaaactatcctctcaacca
catagtactcaacgagcctttgaacaggactgatgggggggcggcggggttggatgaggaacagcgaatagacacacacg
ccaatgggacttttaatggcacgagtcccgggacccctccggcatccccgcagcggcagcagcagccgccatcaacgacg
gacctcgacgcagtgaaggaggcgctccgggacacggccaatgagttcgagctgcgatacgctcgtgccttcagcgacct
tcacagccagctgcacatcacgccggccacggcctaccaaagctttgagaacgtgatggacgaggtgttccgggacggcg
tcaactggggccgcatcgtagggctttttgcgttcggcggggcactgtgtgttgagtgcgtcgagaaggagatgagcccc
ttggtgggcaggatcgtagagtggatgaccgtctacctagacaaccacattcagccctggatccagagccaaggaggatg
ggagcgcttcgctgaaatcttcgggcaggatgcggcggctgaaagccggaggtctcaggagagtttcaagaagtggctgc
tggtggggatgacggtggtgacgggcgttgtggctggtgctcttatcgcgcaaaaacgcctgtga
>gnl|bcl2dbcds|Q9MYW4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcgcagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccggaagggactggaccagagatggagacccccagtgccatcaatggca
acccagcctggcacccggcggacagccccgcggtgaacggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatgacagcagtgaagcaggctctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagcga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaagtagtgaacgaactcttccgggatg
gggtgaactggggccgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtggacaaggagatggag
gtattggtgagtcggatcgcggcgtggatggccacttacctgaatgaccacctggagccctggatccaggagaacggcgg
ctgggacacgtttgtggaactctacggcaacaacgcagcagccgagagccgcaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgaccgtggctggcgtggttctgctgggctccctcttcagccggaaatga
>gnl|bcl2dbcds|A0A3B3I2Q5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L1 (length=654 residues).
atgtcccactgtaacagagagctggtccggttctatttagcctataagatgtcatgcagggactatcctgtgtccctgct
gaagcccacagacgatgggggagaaactgaagaggaccactccgatgcccggaatcgcaggctggtcagcagtgaggacg
gccggctgaggaggtcctgtccctgttgtgctagcatggacgccatcaaatcaactctcaaagattcggccgatgagttt
gaacgtcgtttccatcaaggttttagtgatctctccgtgcagcttcatatcactccagacacggcctaccaaaacttcaa
aagggtgttggatgagctgttcaaggatgggatcaactgggggcgcgttgtgggtttgtttgtctttggtggtgcgctgt
gtgtcgagtgtgtcgagaggaatatgggtgagctggtctcccgcattgctgaatggatgacccagtacctggatgagcaa
ataagtccatggatccacagtcatggaggatgggattgctttgcacggctgtatggccagaacggcgctgcagaagcgag
gagatttcaagagacgctgaagaagtggatgctggtcacagtggcccttttaactggactgctgctgggtgtgctcatca
ccaagaaacggtga
>gnl|bcl2dbcds|A0A3B3I2Q5_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L1 (length=645 residues).
atgactaagtggaagaaatcatggcatctgacctataagatgtcatgcagggactatcctgtgtccctgctgaagcccac
agacgatgggggagaaactgaagaggaccactccgatgcccggaatcgcaggctggtcagcagtgaggacggccggctga
ggaggtcctgtccctgttgtgctagcatggacgccatcaaatcaactctcaaagattcggccgatgagtttgaacgtcgt
ttccatcaaggttttagtgatctctccgtgcagcttcatatcactccagacacggcctaccaaaacttcaaaagggtgtt
ggatgagctgttcaaggatgggatcaactgggggcgcgttgtgggtttgtttgtctttggtggtgcgctgtgtgtcgagt
gtgtcgagaggaatatgggtgagctggtctcccgcattgctgaatggatgacccagtacctggatgagcaaataagtcca
tggatccacagtcatggaggatgggattgctttgcacggctgtatggccagaacggcgctgcagaagcgaggagatttca
agagacgctgaagaagtggatgctggtcacagtggcccttttaactggactgctgctgggtgtgctcatcaccaagaaac
ggtga
>gnl|bcl2dbcds|A0A3B3IB64_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L1 (length=693 residues).
atgtcccggaacagagaactggttgttttctacgtgaagtataaactgtctcagaggaactaccccctcaaccacatagt
gctcaatgagtctccgaacaggactgctgcgggggaggtgggcgaggagcagagcacggagacgcacgccaacgggacgt
ttaacgggacaactcccgggaccccgccgctctccccgctgcgagagcaacagttgccgtcgacgacaaacatggacgca
gtgaaggaggcgctccgggacacggccaacgagttcgagctccggtacgcccttgccttcaacaacctgcacagccagct
gcacatcacgcccgccacggcctaccagagcttcgagaacgtgatgaacgagctgttccgcgacaacatcaactggggcc
gcatcgtggggctcttcgcattcggcggggcgctgtgcgtggagtgcgttgagaaggagatgagccccctggtggaccgg
attgtggagtggatgaccgtctacctggacaaccacatccagccctggatccagagccaaggcggatgggagcgttttgc
tgaaatctttgggcaggaagccgcggctgagagcagaaggtctcaggagagcttcaagaagtggctgctggtggggatga
cggtggcgaccggcgtcctggtgggatccttcctcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3P9I2N4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L1 (length=654 residues).
atgtcccactgtaacagggagctggttcggttctatttagcctataagatgtcatgcagggactatcctgtgtccctgct
gaagcccacagatgatgggggagaaactgaagaggaccactccgctgcccggaacggcaggcaggtcagcagtgaggacg
gccagctgaggaggtcctgtccctgttgtgctagcatggacgccatcaaatcaactctcaaagattcggccgatgagttt
gaacgtcgtttccatcaaggttttagtgatctctccgtgcagcttcatatcactccggacacggcctaccaaaacttcaa
aagggtgttggatgagctgttcaaggatgggatcaactgggggcgcgttgtgggtttgtttgtctttggtggtgcgctgt
gtgtcgagtgtgtagagaggaatatgggtgagctggtctcccgcattgctgaatggatgacccagtacctggatgagcaa
ataagtccatggatccacagtcatggaggatgggattgctttgcacggctgtatggccagaacggcgccgcagaagcaag
gagatttcaagagacgctgaagaagtggatgctggtcacagtggcccttttaactggactgctgctgggtgtgctcatca
ccaagaaacggtga
>gnl|bcl2dbcds|A0A3P9I2N4_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L1 (length=645 residues).
atgactaagtggaagaaatcatggcatctgacctataagatgtcatgcagggactatcctgtgtccctgctgaagcccac
agatgatgggggagaaactgaagaggaccactccgctgcccggaacggcaggcaggtcagcagtgaggacggccagctga
ggaggtcctgtccctgttgtgctagcatggacgccatcaaatcaactctcaaagattcggccgatgagtttgaacgtcgt
ttccatcaaggttttagtgatctctccgtgcagcttcatatcactccggacacggcctaccaaaacttcaaaagggtgtt
ggatgagctgttcaaggatgggatcaactgggggcgcgttgtgggtttgtttgtctttggtggtgcgctgtgtgtcgagt
gtgtagagaggaatatgggtgagctggtctcccgcattgctgaatggatgacccagtacctggatgagcaaataagtcca
tggatccacagtcatggaggatgggattgctttgcacggctgtatggccagaacggcgccgcagaagcaaggagatttca
agagacgctgaagaagtggatgctggtcacagtggcccttttaactggactgctgctgggtgtgctcatcaccaagaaac
ggtga
>gnl|bcl2dbcds|A0A3P9JYH1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L1 (length=693 residues).
atgtcccggaacagagaactggttgttttctacgtgaagtataaactgtctcagaggaactaccccctcaaccacatagt
gctcaatgagtctccgaacaggactgctgcgggggaggtgggcgaggagcagagcacggagacgcacgccaacgggacgt
ttaacgggacaactcccgggacccccccgctctccccgctgcgagagcaacagttgccgtcgacgacaaacatggacgca
gtgaaggaggcgctccgggacacggccaacgagttcgagctccggtacgccctggccttcaacaacctgcacagccagct
gcacatcacgcccgccacggcctaccagagcttcgagaacgtgatgaacgagctgttccgcgacaacatcaactggggcc
gcatcgtggggctcttcgcattcggcggggcgctgtgcgtggagtgcgttgagaaggagatgagccccctggtggaccgg
attgtggagtggatgaccgtctacctggacaaccacatccagccctggatccagagccaaggcggatgggagcgttttgc
tgaaatctttgggcaggaagccgcggctgagagcagaaggtctcaggagagcttcaagaagtggctgctggtggggatga
cggtggcgaccggcgtcctggtgggatccttcctcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3P9MKK4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L1 (length=654 residues).
atgtcccactgtaacagagagctggtccggttctatttagcctacaagatgtcatgcagggactatcctgtgtccctgct
gaagcccacagacgatgggggagaaactgaagaggaccactccgctgcccggaatggcaggccggtcagcagtgaggact
gccagctgaggaggtcctgtccctgttgtgctagcatggacgccatcaaatcaactctcaaagattcggccgatgagttt
gaacgtcgtttccatcaaggttttagtgatctctccgtgcagcttcatatcactccggacacggcctaccaaaacttcaa
aagggtgttggatgagctgttcaaggatgggatcaactgggggcgcgttgtgggtttatttgtctttggtggtgcgctgt
gtgtcgagtgtgtagagaggaatatgggtgagctggtctcccgcattgctgaatggatgacccagtacctggatgagcaa
ataagtccatggatccacagtcatggaggatgggattgctttgcacggctgtatggccagaacggcgctgcagaagcgag
gagatttcaagagacgctgaagaagtggatgctggtcacagtggcccttttaactggactgctgcttggtgtgctcatca
ccaagaaacggtga
>gnl|bcl2dbcds|A0A3P9MKK4_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L1 (length=645 residues).
atgactaagtggaagaaatcatggcatctgacctacaagatgtcatgcagggactatcctgtgtccctgctgaagcccac
agacgatgggggagaaactgaagaggaccactccgctgcccggaatggcaggccggtcagcagtgaggactgccagctga
ggaggtcctgtccctgttgtgctagcatggacgccatcaaatcaactctcaaagattcggccgatgagtttgaacgtcgt
ttccatcaaggttttagtgatctctccgtgcagcttcatatcactccggacacggcctaccaaaacttcaaaagggtgtt
ggatgagctgttcaaggatgggatcaactgggggcgcgttgtgggtttatttgtctttggtggtgcgctgtgtgtcgagt
gtgtagagaggaatatgggtgagctggtctcccgcattgctgaatggatgacccagtacctggatgagcaaataagtcca
tggatccacagtcatggaggatgggattgctttgcacggctgtatggccagaacggcgctgcagaagcgaggagatttca
agagacgctgaagaagtggatgctggtcacagtggcccttttaactggactgctgcttggtgtgctcatcaccaagaaac
ggtga
>gnl|bcl2dbcds|A0A3B3DHA1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias melastigma GN=BCL2L1 (length=693 residues).
atgtcccgcaacagagaactggttgttttctacgtgaagtataaactgtctcagaggaactaccccctcaaccacatagt
gctcaatgagtctccgaacaggactgctgcgggggaggtgggcgaggagcagagcacagagacgcacgccaacgggacgt
ttaacgggacgagtcccgggaccccgccgctatccccgctgcgtcagcagcagttgccgtcgacgacgaacatggacgca
gtgaaggaggcgctccgggacacggccaacgagttcgagctgcggtacgccctggccttcaacaacctgcacagccagct
gcacatcacgcccgccacggcctaccagagcttcgagaacgtgatgaacgagctgttccgcgacaacatcaactgggggc
gcatcgtggggctcttcgcgttcggcggggcgctgtgcgtcgagtgcgtggagaaggagatgagccccctggtggacagg
attgtggagtggatgaccgtctacctggacaaccacatccagccgtggatccagagccaaggcggatgggagcgttttgc
tgaaatctttgggcaggaggccgcagccgaaagcagaaggtctcaggagagcttcaagaagtggctgctggtggggatga
cggtggcgaccggcgtcctggtgggatccttcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3B3E2W4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias melastigma GN=BCL2L1 (length=654 residues).
atgtcccactgtaaccgagagctggtgcagttctatttaggctataagatgtcatccagagactatcctgtgtccctgct
gaaacccacagatgatgggggacaaactgcagaggaccgctctgctacctgcaacggcacactggtcaacagcgaggacg
gccagctgaagaagtcctgcccctgttgtgctagcatggatgccatcaaatccacccttaaagattcggccaatgagttt
gagcgtcgcttcagtcaaggttttagtgatctctctctgcagtttcacatcactcctgacacggcctaccaaaacttcaa
aagtgtgttggatgagctgttcaaggatgggataaactgggggcgtgttgtgggtttgtttgtctttggtggtgtgctgt
gtgttgagtgtgtcgagaggaatatgagtgagctggtctcccgcattgctgaatggatgaccatgtacctagacgagcaa
ataagtccatggatccacagtcaaggaggatgggattgctttgcacagctgtatgggcaggatggcgctgcagaagcgag
aagatttcaagagacgctgaaaaagtggacgctggtcgcagtggcacttctaaccggactgctgcttggtttgctcattg
ccaagaaacggtga
>gnl|bcl2dbcds|C1BLI0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Osmerus mordax GN=BCL2L1 (length=669 residues).
atgtcttacagtaaccgtgagctggtggtgttcttcataagctataaactttcacagaggaattatcctatttctcagtt
gggactggaagatgccagtgaacggactaatgttgacaagaccaatgtctccccagttaatggatctgttgaaaatgacc
gaaattgcataggcagtctggggatatcttcatctccacaggggggtatagaggcggttaaagcagctcttagagactct
gcagatgagtttgaattgcgttacaccagagccttcaatgatccctcttctcaactgcatatcacccctgctacagcata
ccatagctttgaaagtgtaatgaacgaggtgttcagggacggcgtcaactggggacgtgtagtaggcctgtttgcttttg
gtggtgctctttgtgctgagtgtgtcgagaaggatatgagtcacctggtagcgcgtattgcagattggatgaccacctac
ctggacaaccacatccagccatggatacagagacagggtggatgggaccgatttgctgacattttcggcagggatgctgc
tgctgaggttcgacgttcccaggagaacctaagaagatggctgctagtaggggcgatactgcttgcaggagtgttggtcg
gctctctcattgcaaagaaacatcattga
>gnl|bcl2dbcds|H0X6V2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Otolemur garnettii GN=BCL2L1 (length=699 residues).
atgtctcagagcaaccgggagctggtggttgactttatctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagaacaggactgaggccccagaagggaatgaatcagagctggagacccccagtgccattaatggca
acccatcctggcacctggctgacagccccacggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcactgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatctcagctgcacatcaccccagggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgaattgtggcctttttctccttcggcggggctctgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacttgaatgaccacctagagccttggatccaggagaacggcgg
ctggtggaggtgtcaggcctttccagagcttctctctcccaaatcaaattccatttatttcaaagtttgcatgtgtggca
atttttgctctttggctgcagctgggagatgcttgactataggagttatgggttattct
>gnl|bcl2dbcds|Q9MZS7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ovis aries GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggacagaatcagatatggaaacccccagtgccatcaatggca
acccatcttggcacctggcggatagccctgcggtgaatggagccaccggccacagcagaagcttggatgcccgggaagtg
atccccatggcagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacgtcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggctacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacgtttgtggaactctacgggaacaacgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|W5PSA5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ovis aries GN=BCL2L1 (length=699 residues).
atgtctcagagcaaccgggaactagtggttgactttctctcttacaagttttttcagaaaggatacagctggagtcagtt
tagtgacatggaagagaacagaactgagaccctagaagggacagaatcagatatggaaacccccagtgccatcagtggca
acccatcctggcacctggcagatagccctgtggtgaatggagccactggtcacagcagaagcttggacaccgggaaaatg
atccccatggcagtggtgaagcaagccctgagggaggcaagcaatgagtgtgaattgaggtaccaacagacattcagcga
cctgacgtcccagctccacatcaccccagggaaagcatatcagagctttgaacaggtaataaatgaactcttccaggatg
gggtgaactggggtcgcaatgtggcctttttctccttcggtggggcactatgcatgaaaagcatagtcaaggagatgcag
gtattggtaagtcaggtcacgacttggatggccacttacctaaatgaccacctagagccttggatccaggagaatggcga
ctgggacatttttgtggaactctacgaaaacaatacagcaaccgagagccaaaagggccaagagcacctcaaccgctggt
ccctgacggacatgactgtggccggtatggctctgctgggcttgctcttcaactgtaag
>gnl|bcl2dbcds|A0A2R8Z9D7_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Pan paniscus GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggatacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2R8Z9D7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Pan paniscus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A096NV05_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Papio anubis GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggatacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctaggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A096NV05_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Papio anubis GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctaggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A3B3QRZ2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Paramormyrops kingsleyae GN=BCL2L1 (length=714 residues).
atgtcttacagcaacagagaactggtgatggacttcataacgtataaactgtcccagaggaactacaatggccactttgg
gcttcctgaagacaggggtcggacagagggctcgggtcaggccgatgggcgcgagggggttatggtaacagcaactcatg
tcaatgggtcggtcattgctggcggcaccagcagccaggtgtccccagtgcctgagcagccgctccattccccatcgccc
tctccacaaggcctggaggcggtgaaggaggcattgcgggattctgccaacgagtttgagctacgctacagccgcgcctt
cagcgacctctcctcccagcttcacatcacacccgtcacggcctaccagagctttgagagtgtaatgaacgaggtgttcc
gcgatggaatcaactggggccgcatcgtgggcctctttgcctttggcggggccctgtgcgtggagtgtgtggagaaggag
atgggccacctggtggatcgtattgctgactggatgaccgtttacctggacagcaacatccagccctggatccagcggca
gggaggatgggaccgttttgctgaaatctttgggaaggatgcagcagctgagagcaggaggtcccaagagaacttcaaaa
agtggctgttagctgggatgacgctcatcactggagttgttgtgggctctctcattgcacagaagcgcctgtga
>gnl|bcl2dbcds|A0A3B3TFR4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Paramormyrops kingsleyae GN=BCL2L1 (length=681 residues).
atgtcctacagcaatagggagctggtagagtactttgtcagctataagctggcccagaagaattactccattgcccacat
catacaggacgaagccgacgagcagacagggggaggtgagggcgaagcagcaggcgctgtggctcatgccaatggatcgg
tcagtagcgggaactctgtgggccagggtgctcccctggaaggcgccaccccccagggcctggaggcggtgaaggaggcg
ctgcgactctcagccaacgaatttgagttccggtaccagcgtgccttcagcgacctgtcgtcacagctgcatatcacgcc
ggccacagcctaccagagcttcgagagcgtcatgaacgaggtgttccgggacggtgtcaactggggccgagtggtgggcc
tcttcgcctttggtggcgcgttgtgcgtggagtgtgtcgagaaggagatgagcccgctggtgggccacattgtggactgg
atgaccgtctacttggacaaccatatccagccctggattcaaacccaaggaggatgggatcgcttcgccgagatcttcgg
caacgacgcagccgccgaaggccgccgctctcgggagaggttccagcagtggctgccggcggcgatggcgctggtcgcgg
gagcgctggtcggcttcctcatcgccaagaaacgccagtga
>gnl|bcl2dbcds|K7F655_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Pelodiscus sinensis GN=BCL2L1 (length=690 residues).
atgtcgaacactaacagggaattagtgattgacttcctctcctacaagctatcgcagaggggacacagctggagctggtt
cgagggggaggatgagatcaggactgaggctgcagaagaggcggagatggcaagcgtccctaatgggagtccatcctggc
atccaggtgccagccacgtagtgaacggggctgccgggcacagtaacagccttgaagcccatgaaagggttccggcagcc
gaagtgaggcaggcgctgagagaggcaggagatgagtttgaattgaggtatcggagggctttcagtgacctcacttccca
gctccacatcaccctgggcacggcttaccagagcttcgagcaggtggtgaatgaactcttccgggacggagtgaactggg
ggcgcattgtggcttttttctcctttggaggagccctgtgcgtggagagtgtggacaaggagatgcaggtgttggtggga
cgcatcgcctcttggatgaccacttacctgactgaccaccttgatccctggatccaagagaatggcggttgggagcgctt
tgtggatctctacgggaacgatgctgctgccaagagcaggaaaggccaggagcagttcaacagggggctgctgacggggg
cgactgtggccggcgtgctcctcctgggctcgctgctgagccgcaagtag
>gnl|bcl2dbcds|A0A3B3ZMX9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Periophthalmus magnuspinnatus GN=BCL2L1 (length=708 residues).
atgtccctcaacagagaactggtggaattctacatccagtacaaactgtctcagcgggactgtcctctgcagcacctggg
gctgggggacaggagcacacagagtgacacggagcatcttggacttggggataggggcgtagacagggctcggctgcaga
gagaaacagaggtggacagtacggaactcagacttgactccgcctctgattctgcccccgtccacagccccgcccccttg
ttggacctggacgccgttaaagaggctcttcgtgactccgctaatgagttcgagctccgttttagccgcgctttcagcga
cctgcaccgccagctgcacatcacgcccgccacagcctatcagagcttcgagagtgtcatggacgaagtgttccgcgatg
gcgttaactgggggcgtgtcgttggcctgtttgccttcgggggcgctctcgctgtggagtgtgtggacaaagagatgagc
accctagtggctcgcatcgtcacctggatgactgtgtatctggacgaacacatccaagactggatcgactcgcaaggggg
atgggcccgtttcgcagagatctacgggcaggacgccgccgcgcagagccgccattccgaagaacgcttcaagaaatggc
tttttgccggaatgaccctggtcaccggggtcgtggtggggtcactgctcgcccagagacgcctgtga
>gnl|bcl2dbcds|A0A3B3ZMX9_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Periophthalmus magnuspinnatus GN=BCL2L1 (length=645 residues).
atgtccctcaacagagaactggtggaattctacatccagtacaaactgtctcagcgggactgtcctctggggctggagga
tggtacggagattgacacagagagagacagggaccttctgggactgggggacaggagcgtggacaggaactccaccccct
cacttagactcagacttgactccgcctctgattctgcccccgctcttcgtgactccgctaatgagttcgagctccgtttt
agccgcgctttcagcgacctgcaccgccagctgcacatcacgcccgccacagcctatcagagcttcgagagtgtcatgga
cgaagtgttccgcgatggcgttaactgggggcgtgtcgttggcctgtttgccttcgggggcgctctcgctgtggagtgtg
tggacaaagagatgagcaccctagtggctcgcatcgtcacctggatgactgtgtatctggacgaacacatccaagactgg
atcgactcgcaagggggatgggcccgtttcgcagagatctacgggcaggacgccgccgcgcagagccgccattccgaaga
acgcttcaagaaatggctttttgccggaatgaccctggtcaccggggtcgtggtggggtcactgctcgcccagagacgcc
tgtga
>gnl|bcl2dbcds|A0A3B4BFZ8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Periophthalmus magnuspinnatus GN=BCL2L1 (length=657 residues).
atgtctcccagtaaccgagagctggttgaattcttcataagctacaaattatcacagaaaaactacccaagttcgctgct
tatgtcagaccccgctagggtccagtgtgagggcaacaaggcagctaatgtcccgaatggtatgctaacaaaccggaatg
gcaacagacaaacactggcctcactgcctcctgatgatcacttagacgctattaagactgctctgacggactctgcagat
gaatttgaagagttgttcacacaagcattcagcaacctttcctctcagctcgacatcacacctgatacagcttataacag
ctttaaaagtgtcatggacgaggtgttcaaagatggggttaattggggacggattgtgggtctttttgtttttggagggg
ttttgagtgtggagtgtgtggagaaggatatgagcattctggttcctcgcattgctaactggatgactatctacctggat
gagaatatcgccacgtggattcaaaaccagggaggctgggccagctttgctcaaatttttgggcagaatgcagcaggaga
ggccagaaggtcccgagagactctgaagaaatggctgctagttggagtagggttgctagctggagtgctggttgctatgc
tcattgctaagaaatag
>gnl|bcl2dbcds|A0A346RRN1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Perna viridis GN=BCL2L1 (length=558 residues).
atgaaccagtacagttcacgttatttagtggtcgattttgtgaacgaccgactaagaaagaatggattacaatgggaaaa
ctgtccctcgttggaagtcccaccttcacaagttcagctcacattacggacgattggggacgaatttcaggaacgatttc
gcacacaatttgacgatatggtcgatcagttacatataacggaagcaacagcatatcctactttccaaagagttgttcaa
gagttattcattgatgggaatataaactgggggagggtcgttgccttgttcggttttggaggggccctctcagtagaatg
tgtacaaaatggaatgccacaacttgtagactcgatcgttgactgggtttctgtatatttatgtgataatttagaaccat
ggattacttcaaatggtggctggcagggctttgtggaatactataaccaagcacagaaccataatgacaatcagtggaac
ttgggagaatttgtacgttatggggccattggtgtggttggtgcccttgcccttggtgctttactacaaagggtatga
>gnl|bcl2dbcds|A0A087X9B7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Poecilia formosa GN=BCL2L1 (length=696 residues).
atgtcacgaaacagagaactggtgcttttctacattaagtttaaactgtctcagaggaactatccgatccaacacatatt
gcccaatgagcccccggacagcaccgctgctggggacgcggccggggacgcggggatggacgacgagcagacgttggaga
cgcacgctaatgggacttttaacgggacaagtccaggatccccgaggcggcaacaggcggcgtcggcggcaacgatggac
gcggtgaaagtgaccctgcgagacacggcccgtgagttcgagctgcgctactcccgcgccttcaacgaccttcacagcac
gctgcacatcacaccggccaccgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactggg
gccgcatcgtggggctcttcgcgtttggtggcgcgctctgcgtggaatgcgttgagaaggagatgagccacctggtagcc
aggattgtagagtggatgaccgtctacttggatgagcggattgaaccttgggtggagagccaaggaggatgggaccgttt
cgctgagatcttcgggggcaacgcggcggcagagagcagaagatctcaggagagcttcaaaaactggctgctgctgggga
tgagtgtggtgacggccttcatagccgggtccatcttcgcccagaagcgcctgtga
>gnl|bcl2dbcds|A0A087YBW4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Poecilia formosa GN=BCL2L1 (length=660 residues).
atgtcctacagcaacagagaactggtggagttctacataagctacaaattgtctcagagaaactattcaagctctctgct
gaggtccgaggccgacggggccaggaccaattgggatggggacagccggggccctagcaatggtccgctggtcaacagct
gggccggctccccagggaagtcccgggaccctcccaccggcgtcaaggttgtcaaattggttctgaaggacgcggcagag
gagtttgaacgcctctacacccaaagctttaaacacctttccttgcagctggacatcacccccgacacggcctaccagag
cttcaagaccgtgctggatgagttgttcaagggtgaggtcaactggggtcgggtggtggccatgtttacctttgggggaa
ttctgtgtgtggattgcgttcagaagaatatgagtgagctggtctcccgcattgccgaatggatgaccacttacctggac
gagcagctcaatccctggatccaaagccagggaggatgggaccgcttcgctaacctgtacggccaggatgccgctgcaga
gggccggaggtttcgggagaccttgaacaaatggctgctagtcggtgtggctctgctgaccggagctctgctcgtcatgt
tcgtcgctaagaaacgatga
>gnl|bcl2dbcds|A0A3B3TUS7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Poecilia latipinna GN=BCL2L1 (length=696 residues).
atgtcacgaaacagagaactagtgcttttctacattaagtttaaactgtctcagaggaactatccgatccaacacatatt
gcccaatgagcccccggacagcaccgctgctggggacgcggccggggacgcggggatggacgacgagcagacgttggaga
cgcacgctaatgggacttttaacgggacaagtccaggatccccgaggcggcaacaggcggcgtcggcggcaacgatggac
gcggtgaaagtgaccctgcgagacacggcccgtgagttcgagctgcgctactcccgcgccttcaacgaccttcacagcac
gctgcacatcacaccggccaccgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactggg
gccgcatcgtggggctcttcgcgtttggtggcgcgctctgcgtggaatgcgttgagaaggagatgagccacctggtagcc
aggattgtagagtggatgaccgtctacttggatgagcggattgaaccttgggtggagagccaaggaggatgggaccgttt
cgctgagatcttcgggggcaacgcggcggcagagagcagaagatctcaggagagcttcaaaaactggctgctgctgggga
tgagtgtggtgacggccttcatagccgggtccatcttcgcccagaagcgcctgtga
>gnl|bcl2dbcds|A0A3B3VWI7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Poecilia latipinna GN=BCL2L1 (length=660 residues).
atgtcctacagcaacagagaactggtggagttctacataagctacaaattgtctcagagaaactattcaagctctctgct
gaggtccgaggccgacggggccaggaccaattgggatggggacagccggggccctagcaatggtccgctggtcaacagct
gggccggctccccagggaagtcccgggaccctcccaccggcgtcaaggttgtcaaattggttctgaaggacgcggcagag
gagtttgaacgcctctacacccaaagctttaaacacctttccttgcagctggacatcacccccgacacggcctaccagag
cttcaagaccgtgctggatgagttgttcaagggtgaggtcaactggggtcgggtggtggccatgtttacctttgggggga
ttctgtgtgtggattgcgttcagaagaatatgagcgagctggtctcccgcattgccgaatggatgaccacttacctggac
gagcagctcaatccctggatccaaagccagggaggatgggaccgcttcgctaacctgtacggccaggatgccgctgcaga
gggccggaggtttcgggagaccttgaacaaatggctgctagtcggtgtggctctgctgaccggagctctgctcgtcatgt
tcgtcgctaagaaacgatga
>gnl|bcl2dbcds|A0A3B3WI27_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Poecilia mexicana GN=BCL2L1 (length=696 residues).
atgtcacgaaacagagaactggtgcttttctacattaagtttaaactgtctcagaggaactatccgatccaacacatatt
gcccaatgagcccccggacagcaccgctgctggggacgcggccggggacgcggggatggacgacgagcagacgttggaga
cgcacgctaatgggacttttaacgggacaagtccaggatccccgaggcggcaacaggcggcgtcggcggcaacgatggac
gcggtgaaagtgaccctgcgagacacggcccgtgagttcgagctgcgctactcccgcgccttcaacgaccttcacagcac
gctgcacatcacaccggccaccgcgtaccagagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactggg
gccgaatcgtggggctcttcgcgtttggtggcgcgctctgcgtggagtgtgtggagaaggagatgagccacctggtagcc
aggattgtagagtggatgaccgtctacttggatgagcggattgaaccttgggtggagagccaaggaggatgggaccgttt
cgctgagatcttcgggggcaacgcggcggcagagagcagaagatctcaggagagcttcaaaaactggctgctgctgggga
tgagtgtggtgacggccttcatagccgggtccatcttcgcccagaagcgcctgtga
>gnl|bcl2dbcds|A0A3B3XN57_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Poecilia mexicana GN=BCL2L1 (length=660 residues).
atgtcctacagcaacagagaactggtggagttctacataagctacaaattgtctcagagaaactattcaagctctctgct
gaggtccgaggccgacggggccaggaccaattgggacggggacagccggggccctagcaatggcccgctggtcaacagct
gggccggctccccagggaagtcccaggaccctcccaccggcgtcgaggttgtcaaatcggttctgaaggacgcggcagag
gagtttgaacgcctctacacccaaagctttaaacacctttccttgcagctggacatcacccccgacacggcctaccagag
cttcaagactgtgctggatgagttattcaagggtgaggtcaactggggtcgggtggtggccatgtttacctttgggggaa
ttctgtgtgtggattgcgttcagaagaatatgagtgagctggtctcccgcattgccgaatggatgaccacttacctggac
gagcagctcaatccctggatccagagccagggaggatgggaccgcttcgctaacctgtacggccaggacgccgctgcaga
gggccggaggtttcgggagaccttgaacaaatggctgctagtcggtgtggctctgctgaccggagctctgctcgtcatgt
ttgtcgctaagaaacgatga
>gnl|bcl2dbcds|A0A3P9N9Y4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Poecilia reticulata GN=BCL2L1 (length=696 residues).
atgtcacgaaacagagaactggtgcttttctacattaagtttaaactatctcagaggaactatccgatccaacacatatt
gcccaatgagcccccggacagcaccgctgccagggacgcggccggggacggggggatggacgacgagcagacgttggaga
cgcacgctaatgggacttttaacgggacaagtccaggatccccgaggcggcaacaggcggcgtcggcgtcaacgatggac
gcggtgaaagtgaccctgcgagacacggcccgtgagttcgagctgcgctactcccgcgccttcaacgaccttcacagcac
gctgcacatcacaccggccaccgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactggg
gccgcatcgtggggctcttcgcgtttggtggcgcgctctgcgtggagtgtgtggagaaggagatgagccacctggtagcc
aggattgtagagtggatgaccgtctacctggatgagcggattgaaccttgggtggagagccaaggaggatgggagcgttt
cgctgagatcttcgggggcaacgcggcggcagagagcagaagatctcaggagagcttcaaaaactggctgctgctgggga
tgagcgtggtgacggccttcatagccgggtccatctttgcccagaagcgcctgtga
>gnl|bcl2dbcds|A0A3P9QFB3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Poecilia reticulata GN=BCL2L1 (length=654 residues).
atgtcctacagcaacagagaactggtggagttctacataagctacaaattgtctcagagaaactattcaagctctctgct
gaggtccgaggccgacggggccaggaccaattgggacggggacagccggggccctagcaatggcccgctggtcaacagcc
gggctggctcccgggggaagtcccagggccctcccgtcgaggtcgtcaaatcggttctgaaggacgcggcagaggagttt
gaacgcctctacacccaaagctttaaacacctttccttgcagctggacatcacccccgacacggcctaccacagcttcaa
gaccgtgctggatgagttgttcaagggcgaggtcaactggggtcgggtggtggccatgtttacctttggggggattctgt
gtgtggactgcgtccagaagaatatgagcgagctggtctcccgcattgctgaatggatgaccacttacttggacgagcag
ctcaatccctggatccagagccagggaggatgggaccacttcgctaacctgtacggccaggacgccgctgcagagggccg
gaggtttcgggagaccttgaacaaatggctgctagtcggtgtggctctgctgaccggagctctgctcgtcatgtttatcg
ctaagaaacgatga
>gnl|bcl2dbcds|A0A2J8VIH3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Pongo abelii GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagctgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K6G3C5_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Propithecus coquereli GN=BCL2L1 (length=438 residues).
atgcagaagagaacaggactgaggccccagaagcgactgaatcggagatggagacccccagtgccattaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgagatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggccctctgcgtcgaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcaact
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
cggaaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgctggttcctgacgggcatgactgtggctg
gcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K6G3C5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Propithecus coquereli GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tatcgatgcagaagagaacaggactgaggccccagaagcgactgaatcggagatggagacccccagtgccattaatggca
acccatcctggcacctggcggacagccccccagcgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcactgaaggaggcgggcgatgaatttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccctagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgagatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggccctctgcgtcgaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacggaaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A3B4FNX1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Pundamilia nyererei GN=BCL2L1 (length=702 residues).
atgtctcaaaacagagaacttgtgcttttctacataaggtataaactctcccagagaaactatcctctcaaccacatagt
actcaacgagccttcgaacaggactgatgggggggcagcggggttggatgaggaacagcgaatagacacacacgccaatg
ggacttttaatggcaccagtcccgggaccccaccggcatccccgcagcggcggcagcagcagccgccatcaacgacggac
ctcgacgcagtgaaggaggcgctccgggacacggccaatgagttcgagctgcgatacgctcgtgccttcagcgaccttca
cagccagctgcacatcacgccggccacggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtta
actggggccgcatcgtagggcttttcgcgttcggcggggcactgtgtgtcgagtgcgtcgagaaggagatgagccccttg
gtgggcaggatcgtagagtggatgacggtctacctagacaaccacattcagccctggatccagagccaaggaggatggga
gcgcttcgctgaaatcttcgggcaggatgcggcggctgaaagccggaggtctcaggagagtttcaagaagtggctgctgg
tggggatgacggtggtgacaggcgttgtggcgggtgcgcttatcgcgcaaaaacgcctgtga
>gnl|bcl2dbcds|A0A3B4DTL9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Pygocentrus nattereri GN=BCL2L1 (length=717 residues).
atgtcttactacaacagagaactggttgtgtactttatcaagtacaaactctcccagaggaactatccctataaccacat
tgggcttatggaagacacaaatcggactgaagggggtcaggcggcagaggagaacgcagagggggcggcggtgacgccca
cggcagttgtcaacggatccgtaaatgggacaagtcacggtccagcggggtcgcccacctcttccccccaaagaaggtcc
aacggggccggagggctggacgccgtgaaggaagcactgcgggactcagccaacgagtttgagctgcgatattcacgcgc
ctttagcgacctctcctcccagctccatatcacgccagccacggcgtatcagagcttcgaaagcgtgatggacgaggtgt
tccgagacggcgtcaactggggccgtgttgtgggcctgttcgcgttcggtggggccctgtgcgtggagtgtgtggaaaag
gagatgagcccactcgtgggacgcatcgcagagtggatgactgtctacttggacaaccatatccagccctggatccagga
acaaggaggatgggagcgctttgcagagatctttgggaaggatgccgcagcagagagcagaaggtcacaggagaacttta
agaagtggctgctggcagggatgaccctggtcacaggggttgtggtgggctccctcatcgctcagaagcgtctgtaa
>gnl|bcl2dbcds|P53563_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
tagcgatgtcgaagagaacaggactgaagccccagaagaaactgaaccagaaagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagccccgcggtgaatggagccactggccacagcagcagtttggatgcgcgggaggta
atccccatggcagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcggtaccggagagcattcagtga
tctaacatcccagcttcatataaccccagggacagcatatcagagctttgaacaggtagtgaatgaactctttcgggatg
gggtaaactggggtcgcattgtggccttcttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggatctctacgggaacaatgcagcagccgagagccggaaaggccaggagcgtttcaaccgctggt
tcctgacgggcatgactgtggctggtgtagttctgctgggctcactcttcagtcggaagtga
>gnl|bcl2dbcds|P53563_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2L1 (length=855 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
tagcgatgtcgaagagaacaggactgaagccccagaagaaactgaaccagaaagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagccccgcggtgaatggagccactggccacagcagcagtttggatgcgcgggaggta
atccccatggcagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcggtaccggagagcattcagtga
tctaacatcccagcttcatataaccccagggacagcatatcagagctttgaacaggtagtgaatgaactctttcgggatg
gggtaaactggggtcgcattgtggccttcttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggtaagaaccacgccccttgtgtgtccgccccttgtgtgtctctcctctgtggagatccctaactgccctttttggt
ctcctggcatggttgttgaagatatcgattattcaggagacattcctggcttcactttaataccaggggttaactttggg
aatattgatgaccctgtttttaaggaacctgtatttttcattctggctacccttgtggccccgcagtttcatagttttgt
tccaatttctcggcaaagaaaaacagcctgtgtgtttacttggcttaaaacctag
>gnl|bcl2dbcds|P53563_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2L1 (length=855 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
tagcgatgtcgaagagaacaggactgaagccccagaagaaactgaaccagaaagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagccccgcggtgaatggagccactggccacagcagcagtttggatgcgcgggaggta
atccccatggcagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcggtaccggagagcattcagtga
tctaacatcccagcttcatataaccccagggacagcatatcagagctttgaacaggtagtgaatgaactctttcgggatg
gggtaaactggggtcgcattgtggccttcttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggtaagaaccacgccccttgtgtgtccgccccttgtgtgtctctcctctgtggagatccctaactgccctttttggt
ctcctggcatggttgttgaagatatcgattattcaggagacattcctggcttcactttaataccaggggttaactttggg
aatattgatgaccctgtttttaaggaacctgtatttttcattctggctacccttgtggccccgcagtttcatagttttgt
tccaatttctcggcaaagaaaaacagcctgtgtgtttacttggcttaaaacctag
>gnl|bcl2dbcds|A0A2K6QFA2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K6QFA2_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttatctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K6QFA2_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K6UWY8_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L1 (length=441 residues).
atgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatgctccacat
cacccccgggacagcgtatcaaagctttgaacaggtagtgaacgaactcttccgggatggggtgaactggggtcgcattg
tggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaagtattggtgagtcggatcgca
gcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaact
ctatggaaacaatgcagcagccgagagcagaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtgg
ccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|A0A2K6UWY8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccagcctggcacctggcggacagccccgcggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcaataaagcaagcactgagggaggcaggcgacgagtttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcgtatcaaagctttgaacaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaa
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcagcagccgagagcagaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|E2IV77_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Saimiri boliviensis GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccagcctggcacctggcggacagccccgcggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcaataaagcaagcactgagggaggcaggcgacgagtttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcgtatcaaagctttgaacaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaa
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcagcagccgagagcagaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|B5XAY3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Salmo salar GN=BCL2L1 (length=687 residues).
atgatgacttacaacaacagagaactggtggtgtactatattacctataaactatcacagagggactaccccttcaacca
catggagctcacggaagcccagaatcggactgaggtgggacaggtggaagggggtgcggcagtcctaacatacgtcaacg
ggacgagtcccgggactccaccaccacggcagtcgcccccctcctcccctcggcggacagcgggcctggacgcagtgaaa
gaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagcgttcagtgacctgtcctcccagctacacat
cacgccgtccacagcctaccagagctttgagaacgtgatggacgaggtgttccgggacggtgtcaactggggacgggtgg
tgggcctgttttccttcggaggggccctctgtgtagaatgtgtggacaaggagatgaaccccttggtgggaaggatcaca
gactggatgaccgtctacctggacaaccacatccagccctggatccagagccaaggaggatgggaccggtttgcagagat
ctttggaatggacgctgcagccgagagcaggaagtctcaggagagctttaagaagtggcttctggcagggatgaccctgg
tcacaggagtcgtcgtagggtcactcttcgctcagaaacgcctgtga
>gnl|bcl2dbcds|C0HAD8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Salmo salar GN=BCL2L1 (length=651 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctatagactgtcccagaggaattattcatgttgtcaatt
ggggctggagggtgcaagtggacggactgagggagatgacgccattgcaaatgggtctgtggggaacagcagaagcaatt
tggcgaagccctcatctccacaggggggcatggagccagtgaaagcagcactacgggactcagtggatgagtttgagctg
cgctacacccgcgccttcagtgacctctcctcccagctccacatcacccctgccacagcctaccacagctttgagagtgt
gatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggtctgtttgctttcggcggggccttgtgtgttg
agtgtgttgagaaggatatgagcccactggtggcgcgcatcgcagactggatgaccacctacctggacaaccatatccag
ccctggatccagagccaaggaggatgggaccgttttgcagagatctttggcagagatgctgctgcagacgttcgacggtc
tcaggagagcataattaaatggctgctagttggggtgattctgctttcaggagtgctggtcggcactctcatcatgaaga
aacgccagtga
>gnl|bcl2dbcds|G3WKX6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sarcophilus harrisii GN=BCL2L1 (length=684 residues).
atgtctcacagtaaccgggagctggtggttgactttctttcttacaagctttcacagaagggatacaattggagtcagtt
tgaagatgagaacaggactgaggcctcagaagggacagagatacctagtactgtgaatggcagcccctcttggcaccctg
ctgacagccgtgcagtgagtggggccacaggacacagcagcagcctggatgcccatgagacaattcctgtagctgctgtg
aagcaagctttgagggaggcaggagatgaatttgaactccggtaccggcgggcattcagtgatctgacatcccagctcca
catcactccagggacggcttatcagagttttgagcaggtagtgaatgaactcttccgggatggggtgaactggggccgaa
ttgtggcattcttctccttcggaggggcattgtgtgtggaaagcgtggataaagagatggaagtcttggtagcacgcatc
acctcctggatggccacttacttggatgagcacctagacccatggatccaagaaaatggcggttgggacaccttcgtgga
gctttatgggaatgatgcagcagcagagagccggaagggccaggaacgcttcaacagatggctgctgactggcatgacag
tggctggtgtagtcctgctggggtccctgttcagccggaagtga
>gnl|bcl2dbcds|A0A2U9BIG9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Scophthalmus maximus GN=BCL2L1 (length=669 residues).
atgtcggacagtaacagagagctggtcgagttcttcatcggctataagctgtcccagaggaactacccgacctctctact
gaggccggaggatgctggtggaaggactgagggagacaaggccaactcagctgccagcaatggcttgttggtcgacggcg
gcaacaggtgcggtcagctggggactgacccgttgcccccggacggtggcgtgggggctgtgaaggaggcgctcagggac
tccgctcatgagtttgaacagctcttcaaccaagcgttcagtgacctctccctgcagctcgacatcacccctgacacggc
ctaccaaagctttaagagtgtgatggacgaggtgttcaaggacggagtcaactggggacgtatagtgggcctgttcgctt
ttggcggcgtgctgtgtgtggaatgcgtcgagaagaataggggcgagctggtcgcccgtatcgctgactggatgaccatg
tacctggatgagcacatcagcccctggatccagagccaaggaggctggggctgctttgcggagatttttgggcaaggcgc
cggcgcagaagcaaggagatatcgggagagcgtgaggcgatggctgctagttggagtggggatgctgacaggagtgctga
ttgctatgttcatcgctaagaaacagtga
>gnl|bcl2dbcds|A0A2U9BY16_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Scophthalmus maximus GN=BCL2L1 (length=825 residues).
atgtctcagaacaaagaactggtggttttctacatacagtataaactctcccagaggaaatatcctctcaaccatatggg
acttaatgagcctccgaacaggactgatcggggggaggcaggtttgggggaggaacagcagacagcgccgcatgccaacg
gaactctaaacggcgtgaatcccgggacccccccagagtccccactgcggctgcaacggttgccttcatcgccgagcctg
gatgcagtaaaagaggcccttcgggactcggccaacgagtttgagctgcggtacgcgcgcgccttcagcgatctgcacaa
ccagctgcacatcacgccggccacggcctaccaaagcttcgagagtgtgatgaacgaggtgttccgggacggcgtcaact
ggggccgcatcatagggctttttgcatttggcggggcgctgagtgtggagtgtgtggagaaggagatgagttcgctggtg
ggcaggatcgttgagtggatgacggtgtacctagacaacaacatccagccctggatccaaagtcaaggaggatggacttt
ttgccaccagaccaccaggccagtcaagcccagaaagatgaagatgccccccaggacggtcttccactctgctgacggct
cctgcatctctgggaaggtctggcagaacttgagtcggtacactgcagcaggtcaaagaggagaaaaacaggaaggtgta
cagtgtcatggatgcaacaggctcacccacccccctcctctctctgtggtctgtgttgtggcaggatccctttccctaat
tttctccactgcacgtggtatttaa
>gnl|bcl2dbcds|A0A2U9BY16_BCL2L1-05 BCL2-like 1 gene OS=[Eukaryota] Scophthalmus maximus GN=BCL2L1 (length=774 residues).
gacgccagacaacgattttgtggagaacaccattcaaggcctgagtggattcgtcagcttttctgtaggtttggctttca
cccccaaagtctcctctggatatcagctgaccatggttgtctgaacagaggaaagcagggagacagcctggcacagcgag
cattcactctaacacagactgatcggggggaggcaggtttgggggaggaacagcagacagcgccgcatgccaacggaact
ctaaacggcgtgaatcccgggacccccccagagtccccactgcggctgcaacggttgccttcatcgccgagcctggatgc
agtaaaagaggcccttcgggactcggccaacgagtttgagctgcggtacgcgcgcgccttcagcgatctgcacaaccagc
tgcacatcacgccggccacggcctaccaaagcttcgagagtgtgatgaacgaggtgttccgggacggcgtcaactggggc
cgcatcatagggctttttgcatttggcggggcgctgagtgtggagtgtgtggagaaggagatgagttcgctggtgggcag
gatcgttgagtggatgacggtgtacctagacaacaacatccagccctggatccaaagtcaaggaggatgggagcactttg
ctgaaatcttcgggcaggacgcggcggcagggagtcgaaggtctcaggagagtttcaagaagtggctgctggcagggatg
accctggtgaccggggtcgtggtgggctcactgattgcccagaagcgcctgtga
>gnl|bcl2dbcds|A0A2U9BY16_BCL2L1-04 BCL2-like 1 gene OS=[Eukaryota] Scophthalmus maximus GN=BCL2L1 (length=699 residues).
atgtctcagaacaaagaactggtggttttctacatacagtataaactctcccagaggaaatatcctctcaaccatatggg
acttaatgagcctccgaacaggactgatcggggggaggcaggtttgggggaggaacagcagacagcgccgcatgccaacg
gaactctaaacggcgtgaatcccgggacccccccagagtccccactgcggctgcaacggttgccttcatcgccgagcctg
gatgcagtaaaagaggcccttcgggactcggccaacgagtttgagctgcggtacgcgcgcgccttcagcgatctgcacaa
ccagctgcacatcacgccggccacggcctaccaaagcttcgagagtgtgatgaacgaggtgttccgggacggcgtcaact
ggggccgcatcatagggctttttgcatttggcggggcgctgagtgtggagtgtgtggagaaggagatgagttcgctggtg
ggcaggatcgttgagtggatgacggtgtacctagacaacaacatccagccctggatccaaagtcaaggaggatgggagca
ctttgctgaaatcttcgggcaggacgcggcggcagggagtcgaaggtctcaggagagtttcaagaagtggctgctggcag
ggatgaccctggtgaccggggtcgtggtgggctcactgattgcccagaagcgcctgtga
>gnl|bcl2dbcds|A0A2U9BY16_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Scophthalmus maximus GN=BCL2L1 (length=699 residues).
atgtctcagaacaaagaactggtggttttctacatacagtataaactctcccagaggaaatatcctctcaaccatatggg
acttaatgagcctccgaacaggactgatcggggggaggcaggtttgggggaggaacagcagacagcgccgcatgccaacg
gaactctaaacggcgtgaatcccgggacccccccagagtccccactgcggctgcaacggttgccttcatcgccgagcctg
gatgcagtaaaagaggcccttcgggactcggccaacgagtttgagctgcggtacgcgcgcgccttcagcgatctgcacaa
ccagctgcacatcacgccggccacggcctaccaaagcttcgagagtgtgatgaacgaggtgttccgggacggcgtcaact
ggggccgcatcatagggctttttgcatttggcggggcgctgagtgtggagtgtgtggagaaggagatgagttcgctggtg
ggcaggatcgttgagtggatgacggtgtacctagacaacaacatccagccctggatccaaagtcaaggaggatgggagca
ctttgctgaaatcttcgggcaggacgcggcggcagggagtcgaaggtctcaggagagtttcaagaagtggctgctggcag
ggatgaccctggtgaccggggtcgtggtgggctcactgattgcccagaagcgcctgtga
>gnl|bcl2dbcds|A0A2U9BY16_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Scophthalmus maximus GN=BCL2L1 (length=699 residues).
atgtctcagaacaaagaactggtggttttctacatacagtataaactctcccagaggaaatatcctctcaaccatatggg
acttaatgagcctccgaacaggactgatcggggggaggcaggtttgggggaggaacagcagacagcgccgcatgccaacg
gaactctaaacggcgtgaatcccgggacccccccagagtccccactgcggctgcaacggttgccttcatcgccgagcctg
gatgcagtaaaagaggcccttcgggactcggccaacgagtttgagctgcggtacgcgcgcgccttcagcgatctgcacaa
ccagctgcacatcacgccggccacggcctaccaaagcttcgagagtgtgatgaacgaggtgttccgggacggcgtcaact
ggggccgcatcatagggctttttgcatttggcggggcgctgagtgtggagtgtgtggagaaggagatgagttcgctggtg
ggcaggatcgttgagtggatgacggtgtacctagacaacaacatccagccctggatccaaagtcaaggaggatgggagca
ctttgctgaaatcttcgggcaggacgcggcggcagggagtcgaaggtctcaggagagtttcaagaagtggctgctggcag
ggatgaccctggtgaccggggtcgtggtgggctcactgattgcccagaagcgcctgtga
>gnl|bcl2dbcds|A0A3B4V3T1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Seriola dumerili GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtcgttttctacataaagcataagctctcccagagaaactatcctctcacccacatgga
actcaatgagtctcccaacaggactgatggcggggaggcagggttggttgaggaacagcggatagcgacgcacgccaatg
gaacttttaatggcacaagtcctgggacccgtgcagagtccccgcagcggcagcaacggctgccgtcaacaacgagcctg
gacgcagtgaaagaggccctccgggattccgccaacgagtttgagttgcgatactcccgcgccttcagcgatctgcacaa
ccagctgcatatcacgccggccacagcttaccaaagctttgcgaacgtgatggatgaagtgttccgggacggcttcaact
ggggccgcatcatagggctttttgtgttcggcggggcgctgtgtgtcgagtgtgtggagaaggagatgagtcctctggtg
ggcaggatcgtagagtggatgaccgtctacctggacaaccgcattcagccatggatccagagtcaaggaggatgggagcg
ctttgctgaaatcttcgggcaggacgcagcagcagagagcaggaggtctcaggagagtttcaagaagtggctgctggcgg
ggatgaccctggtgaccggggttgtggtgggctcactgattgcccaaaagcgcctgtga
>gnl|bcl2dbcds|A0A3B4V9K8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Seriola dumerili GN=BCL2L1 (length=666 residues).
atgtcgtacagcaacagagagctggtggagttcttcataagctacaaactgtctcaaagtaactgcccaacctcactgct
gaggccagaggatgctggtggaaggactgagggagacaaggccaactcagctgccagtaatggcttgttggtcaacagca
gtgacaggtgtggtcagcccgggacgtcctcgcccccgcatggtggcatagaggccgtaaagtcagcccttaaggactct
gctgacgaatttgaattgctcttcaaccaagcgtttagtgacctttccacgcagcttgacatcactcctgacactgcata
ccacagctttaagagtgtgatggatgagttgttcaaagatggagtcaactggggacgtatagtgggcctatttgcctttg
ggggtgtactgtgtgtggaatgcatacagaagaatatgagcgagctggtttcccgtatcacagactggatgaccatgtac
ctggatgagcacatcagtccgtggatccagagccaaggaggctgggactgctttgctgagatgtttgggcaagacgccgc
tgcagaagcgaggagatctcgggaagctgtgatgaagtggctgctagttggagtggcaatgttggcaggagtgctgatgg
gcgtgctcatcgttaagaaacattaa
>gnl|bcl2dbcds|A0A3B4XS24_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Seriola lalandi dorsalis GN=BCL2L1 (length=666 residues).
atgtcgtacagcaacagagagctggtggagttcttcataagctacaaactgtctcaaagtaactgcccaacctcactgct
gaggccagaggatgctggtggaaggactgagggagacaaggccagctcagctgccagtaatggcttgttggtcaacagca
gtgacaggtgtggtcagcccgggacgtcctcgcccccgcatggtggcatagaggccgtaaagtcagcccttaaggactct
gctgacgaatttgaattgctcttcaaccaagcatttagtgacctttccacgcagcttgacatcactcctgacactgcata
ccacagctttaagagtgtgatggatgagttgttcaaggatggagtcaactggggacgtatagtgggcctgtttgcctttg
ggggtgtactgtgtgtggaatgcatacagaagaatatgagcgagctggtttcccgtatcgcagactggatgaccatgtac
ctggatgagcacatcagtccgtggatccagagccaaggaggctgggactgctttgctgagatgtttgggcaagacgccgc
tgcagaagcgaggagatctcgggaggctgtgaggaggtggctgctagttggagtggcgatgttggcaggagtgctgatgg
gcgtgctcatcgttaagaaacattaa
>gnl|bcl2dbcds|A0A3B4XU17_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Seriola lalandi dorsalis GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtcgttttctacataaagtataagctctcccagagaaactatcctctcacccacatgga
actcaatgagtctcccaacaggactgatggcggggaggcagggttggttgaggaacagcggatagcgacgcacgccaatg
gaacttttaatggcacgagtcctgggacccgtccagagtccccgcagcggcagcaacggctgccgtcaacaacgagcctg
gacgcagtgaaagaggccctccgggattccgccaacgagtttgagttgcgatactcccgcgccttcagcgatctgcacaa
ccagctgcatatcacgccggccacagcttaccaaagctttgcgaacgtgatggatgaagtgttccgggatggcttcaact
ggggccgcatcatagggctttttgtgttcggcggggcgctgtgtgtcgagtgtgtggagaaggagatgagtcctctggtg
ggcaggatcgtagagtggatgaccgtctacctggacaaccgcattcagccatggatccagagtcaaggaggatgggagcg
atttgctgaaatctttgggcaggacgcagcagcagacagcaggaggtctcaggagagttttaagaagtggctgctggcgg
ggatgaccctggtgaccggggttgtggtgggctcactgatcgcccaaaagcgcctgtga
>gnl|bcl2dbcds|A0A0B4KJI5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sparus aurata GN=BCL2L1 (length=648 residues).
atgtcgtacagtaacagagagctagtggagtcctttttaagctacaaactgtctcagaggaactatccaactgccctgct
gaggccagatgatgctggtggaaggactgaggcagacaaagccaactcagctgccacaaatggcctgctggccaacagca
gcaacgggggcggacagccaggtgctgacatagaggctgttaaagcagctcttcgggactcatctgaagagtttgaactg
ctcttcacacaagcgtttagtgacctctccacgcagctcgacatcactcctgacacagcctaccacagctttaagagcgt
gatggacgaggtgttcaaggacggagtcaactggggacgtgtagtgggcctgtttgcttttggcggtgtgctgtgtgtgg
aatgcgttgagaaggatacgagcgagctggtctcccgcatcgcagactggatgaccatgtacctggatgagcacatcaat
ccgtggattgagagccaaggaggatgggactcctttgctgaggtttttgggcgagacgcagctgcagaagcgaggagatc
tcgggagactctgagtcggtggctgctggttggagtggcgctgctaatgggagttgtgctcggtgtcctcatcgctaaga
aacagtga
>gnl|bcl2dbcds|A0A3B4Z3X2_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Stegastes partitus GN=BCL2L1 (length=690 residues).
atgtctcaaaacagagaactggtggtttactacataaagtataaactctcccagagaaactatcccctcaatcacatggt
gctcaatgaggctcccaacaggactgacgggggggaggcgaggttggctgaggaacagcggacagagacacacgccaacg
ggacttttaatggcacgagtcccgggaccccgccgccgtccccgcggcggttggcgtcgacggcgaccatggacgcggtg
aaggaggccctccgggacacggccaacgagttcgagctgcggtacgcccgcgccttcagcgacctgcacagccagctgca
catcacgccggccaccgcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactggggccgca
tcgtagggcttttcgcgttcggcggggcgctgtgtgtcgagtgcgtcgagaaggagatgagccccctggtgggccggatc
gtagagtggatgacggtttacctggacaaccacattcaggactggatccagagccaaggcggatgggaccgcttcgctga
aatcttcggccaggacgcggcagccgagagccggaggtctcaggagagcttcaagaagtggctgctggtggggatgacgg
tggtgaccggggtcgtggtcggttcgctcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3B4Z3X2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Stegastes partitus GN=BCL2L1 (length=690 residues).
atgtctcaaaacagagaactggtggtttactacataaagtataaactctcccagagaaactatcccctcaatcacatggt
gctcaatgaggctcccaacaggactgacgggggggaggcgaggttggctgaggaacagcggacagagacacacgccaacg
ggacttttaatggcacgagtcccgggaccccgccgccgtccccgcggcggttggcgtcgacggcgaccatggacgcggtg
aaggaggccctccgggacacggccaacgagttcgagctgcggtacgcccgcgccttcagcgacctgcacagccagctgca
catcacgccggccaccgcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactggggccgca
tcgtagggcttttcgcgttcggcggggcgctgtgtgtcgagtgcgtcgagaaggagatgagccccctggtgggccggatc
gtagagtggatgacggtttacctggacaaccacattcaggactggatccagagccaaggcggatgggaccgcttcgctga
aatcttcggccaggacgcggcagccgagagccggaggtctcaggagagcttcaagaagtggctgctggtggggatgacgg
tggtgaccggggtcgtggtcggttcgctcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3B5B4X7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Stegastes partitus GN=BCL2L1 (length=636 residues).
atggaaataatgtcgtacagtaacagagagctagtggagttctttataagctacaagctgtctcaaaggaactatccaac
gtctctgctgaggccggaggatgctgcaggaaggactgagggagacaagaccaactctgctgccagtaacggcttgctgg
tgaacagcagaggcggcatagaggctgtaaaagcagcgcttaaggactcggcagatgagtttgaacttctcttcacgcaa
gcttttagtgacctgtcttcacagcttgacatcactcctgacacggcctaccacagcttcaagagtgtgatggacgaggt
gttcaaggatggggtcaactggggacgtatagtgggcctgttttgctttggcggtgtactgtgtgtggaatgcgtagaca
agaatatgaacgagctggttccccgcatcgcagactggatgaccatgtacctggatgagcacatcagtctgtggatccaa
agccaaggaggatgggagtgctttgctgaaattttcgggcaagacgccgccgcagaagcacggagatctcgggattctct
gaagcgatggctgctagtcggaggggcgctgctaacgggagtgctggctggtgtgctcatcgctaagaaacagtga
>gnl|bcl2dbcds|O77737_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sus scrofa GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tactgatgtggaagagaacagaactgaggccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgaggtaccggagggcattcagtga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagctttgagcaggtattgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacggaaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgatggt
tcctgacgggcatgactctagctggggtggttctgctgggttcgctcttcagtcggaaatga
>gnl|bcl2dbcds|H0Z8G3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Taeniopygia guttata GN=BCL2L1 (length=687 residues).
atgtacagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagaaaggatacagctggagtcagct
ggaagaggaggatgagaacaggactgactttgcaggggaggaggacgagatggacggggtcctcaacgggagcccctcct
ggcacgcggccaccagccacatagtgaatggagccaccgtgcaccagaacagcctcgaagtccatgagatccgtcgagca
gctgatgtgaggcaggcgctgagagaggcgggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcacttc
ccagctccacatcactcccagcacagcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgttaaggagatgagggtattggtg
aaacgcatcgtctcttggatgaccacgtacttgaccgaccacttagatccctggatccaggagaatggcggatgggagcg
ctttgtggactctatgaacgatgctgctgccgagatgagaaaaggccaggagttcaacaaatggctcctgacgggggcga
cggtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A0F7L1T6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Takifugu obscurus GN=BCL2L1 (length=657 residues).
atgtcgtataacaacagagagctggtggagcacttcttaagatacaagctgtctcagaggaactacccatcttctctgct
gagaccagaggatactgatggaaggacagagggagaaaagaggagccccgctgcttccaatggcctgctggtccgcagca
ggaacaggggtggagcgtctccatccgcaggtgctggcattgaggctgtgaacgcagctcttcgggactcggcagaagag
tttgagaagctctttgctcaagcattcagcgacctctcctcacagctcgacatcactcctgacacggcttaccagagctt
taagaatgtgatggacgaggtgttcaaggacggagacaactggggacgagttgtgggactatttgcctttggcggggtac
tatgtgtggaatgtgtcgagagggatgcgagccaactggtttgccgcattgcagactggatgaccatttacctggatgag
catattaacccgtggatccagagtcaaggaggatgggattgcttcgcgaagatttttggggacgacgccgcggcagaggg
gaggagagctcgcgagaacctgagtagatggatgctgggcggattggcgctgctgatgggagttttggtcggcgctttca
tcgtcaagaaacattga
>gnl|bcl2dbcds|A0A3B5K6B9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Takifugu rubripes GN=BCL2L1 (length=657 residues).
atgtctcaaaacagagaactggtcattttctatattaagtacaaactctcccaaagaaattaccctttcaatcacaatgg
actcatattagagcctccaagtaggactgatgggcagtttgtaactactcagttcaatggaacttttaatggtgcaagcc
ctggaacacccccagcaacaagtctggcaacaagtctggatacagtaaaggaagccctccgggacacaggcaatgaattt
gagctgcgatacacttgtgctttcagtgacctgcacaaccagctacacatcaccccagctactgcttaccaaagttttga
gaatgttatggatgaggtatttagggatggagtcaactgggggcggatagtggggctttttgcatttggtggtgctctct
gtgtggagtgtgttgagaaggagatgagtcccctggtgggccggattatagagtggatgacagtctatcttgacaaccac
attcaaccatggatccagagtcaaggaggatgggtccgttttgctgaactctttgggcaggatgcagcagcagaaagcag
gagatctcaggagagattcagaaacggactcctggtggggatgagcctggcagcagggatcgcaatcgggtcgttcatag
tgaggaaactcctgtga
>gnl|bcl2dbcds|A0A3B5K6B9_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Takifugu rubripes GN=BCL2L1 (length=657 residues).
atgtctcaaaacagagaactggtcattttctatattaagtacaaactctcccaaagaaattaccctttcaatcacaatgg
actcatattagagcctccaagtaggactgatgggcagtttgtaactactcagttcaatggaacttttaatggtgcaagcc
ctggaacacccccagcaacaagtctggcaacaagtctggatacagtaaaggaagccctccgggacacaggcaatgaattt
gagctgcgatacacttgtgctttcagtgacctgcacaaccagctacacatcaccccagctactgcttaccaaagttttga
gaatgttatggatgaggtatttagggatggagtcaactgggggcggatagtggggctttttgcatttggtggtgctctct
gtgtggagtgtgttgagaaggagatgagtcccctggtgggccggattatagagtggatgacagtctatcttgacaaccac
attcaaccatggatccagagtcaaggaggatgggtccgttttgctgaactctttgggcaggatgcagcagcagaaagcag
gagatctcaggagagattcagaaacggactcctggtggggatgagcctggcagcagggatcgcaatcgggtcgttcatag
tgaggaaactcctgtga
>gnl|bcl2dbcds|H2U5I3_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Takifugu rubripes GN=BCL2L1 (length=657 residues).
atgtcgtataacaacagagagctggtggagcacttcttaagatacaagctgtctcagaggaactacccaacttctctgct
gagaccagaggatactgatggaaggacagagggagaaaagaggagccccggtgcttccaatggcctgctggtccgcagca
ggaacaggggtggagcgtctccatccgcaggtgctggcatagaggctgtgaacgcagctcttcgggactcggcagaagag
tttgagaagctctttgctcaagcattcagcgacctctcctcacagctcgacatcactcctgacacagcttaccagagctt
taagaatgtgatggacgaggtgttcaaggacggagtcaactggggacgagttgtgggactatttgcctttggcggggtac
tatgtgtggaatgtgtcgagaaggatgcgagccaactggtttgccgcattgcagactggatgaccatttacctggatgag
catattaacccgtggatccagagtcaaggaggatgggattgcttcgcgaagatttttggggacgacgccgcggcagaggg
gaggagagctcgcgagaacctgagtagatggatgctgggcggattggcgctgctgatgggagttttggtcggcgctttca
tcgtcaagaaacattga
>gnl|bcl2dbcds|H2U5I3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Takifugu rubripes GN=BCL2L1 (length=657 residues).
atgtcgtataacaacagagagctggtggagcacttcttaagatacaagctgtctcagaggaactacccaacttctctgct
gagaccagaggatactgatggaaggacagagggagaaaagaggagccccggtgcttccaatggcctgctggtccgcagca
ggaacaggggtggagcgtctccatccgcaggtgctggcatagaggctgtgaacgcagctcttcgggactcggcagaagag
tttgagaagctctttgctcaagcattcagcgacctctcctcacagctcgacatcactcctgacacagcttaccagagctt
taagaatgtgatggacgaggtgttcaaggacggagtcaactggggacgagttgtgggactatttgcctttggcggggtac
tatgtgtggaatgtgtcgagaaggatgcgagccaactggtttgccgcattgcagactggatgaccatttacctggatgag
catattaacccgtggatccagagtcaaggaggatgggattgcttcgcgaagatttttggggacgacgccgcggcagaggg
gaggagagctcgcgagaacctgagtagatggatgctgggcggattggcgctgctgatgggagttttggtcggcgctttca
tcgtcaagaaacattga
>gnl|bcl2dbcds|A0A1U7T4L4_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Tarsius syrichta GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggcctcagaagggactgagtcggagatggagacccccagtgccgtcaatggcaaccca
tcctgggacagcgtatcagagttttgaacaggtagtgaacgaactcttccgggatggggtaaactggggtcgcatcgtgg
cctttttctccttcggcggggcactgtgtgtggagagcgtagacaaggagatgcaggtattggtgagtcggatcgcaact
tggatggccacttacctgaatgaccacctagagccttggatccaggacaacggcggctgggacacttttgtggaactcta
cgggaacaatgcagcagctgagagccggaagggccaggagcgcttcaaccgctggttcctgacgggcatgaccgtagctg
gcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A1U7T4L4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Tarsius syrichta GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagaacaggactgaggcctcagaagggactgagtcggagatggagacccccagtgccgtcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagctgtgaagcaagcgctgagggaggcaggcgatgagtttgaactgcggtaccggcgggcattcagtga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagttttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcatcgtggcctttttctccttcggcggggcactgtgtgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggacaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagctgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgaccgtagctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|H3CH49_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Tetraodon nigroviridis GN=BCL2L1 (length=696 residues).
cgaagtcaccccggagcaaagtcaaaaggcgcatctacgcagaggatgtctctaaacagagaactggtcattttctacat
taaatacaaactttcccaaagaaactaccctttgagtcacattgtagagccttcaagtaggactgaagggcagtttggaa
ccacccagtccaatggaacttttaatggggcaagtcctggaacccccccagcaccctcccagcaccagcagtcattgaca
agtctggacgcagtcaaggaagccctccgggacaccggcaatgaatttgagctgcggtacacctgcgcgttcagtgacct
gcacaaccagctccacatcacgccagccacggcttaccaaagttttgagaacgttatggatgaggtgtttcgggatggag
tcaactgggggcggatagtgggcctttttgccttcggtggtgccctgtgtgtggagtgtgtggagaaggagatgaatcct
ctggttggccggatcatagagtggatgacggtctatctggacaaccacatccagccctggatccagagtcaaggaggatg
ggaacgttttgctgaactcttcgggcaggacgcggctgcagaaagccgcaggtcccaggagcgattccgaaacgggctgt
ttctgggcatgagtctggcggcagggatcgccctcggctccttcatcgtcatgagg
>gnl|bcl2dbcds|A0A452SDS4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ursus americanus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaaggaactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcgctgagggaggccggggatgagttcgaactgaggtaccggcgggcattcagcga
cctgacatcccagcttcacatcaccccagggacagcgtatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcattgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggacactttcgtggaactctacgggaacaatgcagcggctgaaagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A384D3U1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ursus maritimus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaaggaactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcgctgagggaggccggggatgagttcgaactgaggtaccggcgggcattcagcga
cctgacatcccagcttcacatcaccccagggacagcgtatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcattgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggacactttcgtggaactctacgggaacaatgcagcggctgaaagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|Q2TAP5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Xenopus laevis GN=BCL2L1 (length=615 residues).
atggagggcagcagtagagatctggtggagaagtttgttagtaagaaactttcccagaatgaagcctgcaggaagttctc
caataatccccaacccaatgccatatctaatggaacttctacttcagagcgccccggggaaggggccacgcagggcattg
tggaggaggaagtccttcaagcccttttggaagcaacggaggagtttgagttgagatatcagcgtgccttcagtgacctg
acctcacagctgcacatcacccaggacacggcccagcagagcttccagcaagttatgggagagttgttcagggatgggac
aaactgggggagaattgtggctttcttctcatttgggcgggccctatgtgtggagagtgcaaacaaggagatgactgatc
tgctacccagaattgtccagtggatggtgaattatctagagcacacactgcagccctggatgcaggagaatggaggctgg
gaagcttttgtcggcctgtatggaaagaatgccgcagcccagagcagagaaagccaggaacgatttggcaggttgctgac
tatagtgattctgactggtgttttcgcattggtctgctacatgaggcgccgatag
>gnl|bcl2dbcds|Q91828_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Xenopus laevis GN=BCL2L1 (length=615 residues).
atggagggcagcagtagagatctggtggagaagtttgttagtaagaaactttcccagaatgaagcctgcaggaagttctc
caataatcccaacccaatgccatatctaatggaaccttctacttcagagcgccccggggaaggggccacgcagggcattg
tggaggaggaagtccttcaagcccttttggaagcaacggaggagtttgagttgagatatcagcgtgccttcagtgacctg
acctcacagctgcacatcacccaggacacggcccagcagagcttccagcaagttatgggagagttgttcagggatgggac
aaactgggggagaattgtggctttcttctcatttgggcgggccctatgtgtggagagtgcaaacaaggagatgactgatc
tgctacccagaattgtccagtggatggtgaattatctagagcacacactgcagccctggatgcaggagaatggaggctgg
gaagcttttgtcggcctgtatggaaagaatgccgcagcccagagcagagaaagccaggaacgatttggcaggttgctgac
tatagtgatgctgactggtgttttcgcattggtctgctacatgaggcgccgatag
>gnl|bcl2dbcds|A0A3B5MGS2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Xiphophorus couchianus GN=BCL2L1 (length=660 residues).
atggcctacagcaacagagaactggtggagttctacataagctacaaattgtctcagagaaactattcaagctctctgct
gaggtccgaggttgccgggggcaggaccaattgggaaggggacagccgggtccctcgcaatggcccgctggtcaacagct
gggccgggcacccggggaaacccaggggccctccggccggcgtcgaggtcgtcaaatcggttctgaaggacgcggcggag
gagtttgagcgcctctacacccaaagctttaaacacctctccttgcagctggacatcacccccgacacggcctaccacag
cttcaagaccgtgctggacgagttgttcaagggcggggtcaactgggggcgggtggtggccatgtttaccttcgggggga
ttctgtgtgtggactgcgtccagaagaatatgagtgagctggtctcccgcattgccgaatggatgaccacttacctggac
gagcagctcagtccctggatccagagccagggaggatgggaccgctttgctaacctgtacggccaggacgccgctgcaga
gggccggaggtttcgggagaccttgaacaaatggctgctagttggtgtggctctgctgaccggagctctgctcgtcgtgt
tcgtcgctaagaaacgatga
>gnl|bcl2dbcds|A0A3B5PQJ0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Xiphophorus maculatus GN=BCL2L1 (length=684 residues).
atgtcacgaaacagagaactggtgcttttctacattaagtttaaactgtctcagaggaactatccgatccaacacatatt
gcccaacgagcccccggacggcaccgctgccggggacgtggggatggacgacgagcagacgttagagacacacgctaatg
ggacttttaacgggacgagtccaggatcccctaggcggcaccaggcggcgtcggcgtcaacgatggacgcggtgaaagtg
gccctgcgcgacacggcccgtgagtttgagctgcgctactcccgcgccttcaacgaccttcacagcacgctgcacatcac
accggccaccgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactggggccgcatcgtgg
ggctcttcgcgtttggtggcgcgctgtgcgtggagtgcgtggagaaggagatgagccacctggtagccaggattgtagag
tggatgaccgtctacctggatgagcagattgaaccttgggtagaaagccaaggaggatgggagcgcttcgctgagatctt
cgggggcaacgcggcggcagagagcagaagatctcaggagagcttcaaaaactggctgctgctggggatgagcgtggtga
cggccttcatagccgggtccatcttcgcccagaagcgcctgtga
>gnl|bcl2dbcds|M4A558_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Xiphophorus maculatus GN=BCL2L1 (length=660 residues).
atggcctacagcaacagagaactggtggagttctacataagctacaaattgtctcagagaaactattcaagctctctgct
gaggtccgaggttgccgggggcaggaccaattgggaaggggacagccgggtccctagcaatggccggctggtcaacagcc
gggccgggcccccggggaagcccaggggcccaatggccggtgttgaggtcgtcaaatcagttctgaaggacgcggcggag
gagtttgagcgcctctacacccaaagctttaaacacctctccttgcagctggacatcacccccgacacggcctaccacag
cttcaagaccgtgctggacgagttgttcaagggcggggtcaactgggggcgggtggtggccatgtttaccttcgggggga
ttctgtgtgtggactgcgtccagaagaatatgagtgagctggtctcccgcattgccgaatggatgaccacttacctggat
gagcagctcagtccctggatccagagccagggaggatgggaccgctttgctaacctgtacggccaggacgccgctgcaga
gggccggaggtttcgggagaccttgaacaaatggctgctagttggtgtggctctgctgaccggagctctgctcgtcgtgt
tcgtcgctaagaaacgatga
© 1998-2019