Dataset for CDS BCL-2 of organism all

[Download (right click)] [Alignment] [Repertoires]

69 sequence(s)

>gnl|bcl2dbcds|G1LID1_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL-2 (length=489 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcggcccccgccgccgccgccgccgcgggccctgcgctcagccccgtgccacctgtgg
tccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgacttcgcggagatgtccagccagctg
cacctgacacccttcaccgcaaggggacgctttgccacggtggtggaggagctcttcagggatggggtgaactgggggag
gattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggacaaca
ttgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggacaacggaggctgggtaggtgcacgt
ccgcttgaa
>gnl|bcl2dbcds|G1LID1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL-2 (length=549 residues).
ccccaccccgcagcgtccccccggcccttcgtgaggcgctggcaggtggcgccgccaagcgccgccgccgccgccgcggg
ccctgcgctcagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgcc
gcgacttcgcggagatgtccagccagctgcacctgacacccttcaccgcaaggggacgctttgccacggtggtggaggag
ctcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaa
ccgggagatgtcgcccctggtggacaacattgccctgtggatgactgagtacctgaaccggcacctgcacacctggatcc
aggacaacggaggctgggatgcctttgtggagttgtacggccccagcatgcagcctctgtttgacttctcctggctgtct
ctgaaggccctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctacctgggccacaag
>gnl|bcl2dbcds|U3II49_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anas platyrhynchos GN=BCL-2 (length=312 residues).
ggactccacctcgccctgcgccaggccggggacgagttctcccgtcgctaccagcgggacttcgcccagatgtccggcca
gctgcacctgacaccnnnnacggccagaggccgcttcgtggccgtggtggaggagctcttccgagacggggtgaactggg
gccggatcgtggccttcttcgagttcggcggcgtcatgtgcgtggagagcgtcaaccgggagatgtctcccctggtggac
agcatcgccgcctggatgaccgagtacctgaaccggcacctgcacaactggatccaggacaacggaggctgg
>gnl|bcl2dbcds|H9GPE7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anolis carolinensis GN=BCL-2 (length=510 residues).
atggctcatcctgggataagaggttacgacaacagggaaatcgtgctgaggtacatccattacaagctgtcgcagaaagg
atatgactgggttgccagtggagacagaggaaagtcagcatctctttccccagagcttctcaattctgatcctgtgagta
ccaatgcccccagggaagaacctgacccggtgccacaggttgtccatacaacattacgccaagccggagatgagttctcc
cgacgctatcggagggactttgctcaaatgtctggccagctgcatttgacccccagcactgccagaagtcgttttgtggc
cgtggtggaagagctcttccaggacggtgtgaactgggggaggattgtggcgttctttgaatttggtggcatgctgtgcg
tggagagtgtcagccgggagatgtccccccttgtggacaatattgctacgtggatgactgagtatctgaaccagtacctg
cgcaactggatccaggagaacggaggctgg
>gnl|bcl2dbcds|A0A2K5EB04_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Aotus nancymaae GN=BCL-2 (length=723 residues).
atggcgcacgctgggagaacagggtacgataaccgagagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagatgtgggcgccgcacccccaggggccgcccccgcgccgggcatcttctcctcccagcctg
gacacacgcccggtcccgccgcgccccgggacccggtctccaggacctcgccgccgccgcccccggccgcccccgccgcc
gccgccacggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggggacgacttctcccg
ccgctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacgg
tggtggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtg
gagagcgtcaaccgggagatgtcgcccctggtggacaacatcgcgctgtggatgaccgagtacctgaaccggcacctgca
cacctggatccaggataacggaggctgggatgcctttgtggaactgtatggccccagcatgcggcctctgtttgatttct
cctggctgtctctgaagactctgctcagcttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaag
tga
>gnl|bcl2dbcds|F6R2C4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Bos taurus GN=BCL-2 (length=690 residues).
atggcgcacgcggggggaacaggctacgataaccgagagatcgtgatgaagtacatccactataagctgtcgcagcgggg
ctacgagtgggatgccggagacgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcctcccagccgg
gccgcacacccgcgccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgccg
cctgtggtgcacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
tcagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacacctggatccaggacaacggaggctgggacgc
ctttgtggagctgtatggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctgg
ccctggtgggcgcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|O02718_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Bos taurus GN=BCL-2 (length=687 residues).
atggcgcacgcggggggaacaggctacgataaccgagagatcgtgatgaagtacatccactataagctgtcgcagcgggg
ctacgagtgggatgccggagacgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcctcccagccgg
gccgcacacccgccccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgccg
cctgtggtgcacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
tcagctgcacctgacgcccttcaccgcgagggaacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacacctggatccaggacaacggaggctgggacgc
ctttgtggagctgtatggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctgg
ccctggtgggcgcttgcatcaccctgggtgcctatctgggccataag
>gnl|bcl2dbcds|A0A2R8MY14_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Callithrix jacchus GN=BCL-2 (length=723 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagatgtgggcgccgcgcccccaggggccgcccccgcggagggcatcttctcttcccagcccg
ggcacacgcccggtcccgccgcgccccgggacccggtcgccaggacctcgccgccgccgcccccagccgcccccgccgcc
gccgccacggggcctacgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccg
ccgctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacgg
tggtggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtg
gagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgaccgagtacctgaaccggcacctgca
cacctggatccaggataacggaggctgggatgcctttgtggaactgtatggccccagcatgcggcctctgtttgatttct
cctggctgtctctgaagactctgctcagcttggtcctggtgggagcttgcatcaccctgggtgcctatctgggccacaag
tga
>gnl|bcl2dbcds|J9NXG3_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=480 residues).
atggcgcacgctgggcgaacagggtacgataaccgggagatagtgatgaagtacatccactacaagctgtcgcagagggg
ctacgagtgggacgcgggagaggcgggcgccgcgcccccgggggccgcccccgcgccgggcatctccgcctcgcncagcc
ccgtgccacctgtggtccacctgaccctgcgccaggccggcgacgacttctcccgccgctaccggcgtttcgccgagatg
tccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttcagggatggggt
gaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccc
tggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggatccaggacaacggaggctgg
>gnl|bcl2dbcds|J9NXG3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=654 residues).
atgaagtacatccactacaagctgtcgcagaggggctacgagtgggacgcgggagaggcgggcgccgcgcccccgggggc
cgcccccgcgccgggcatctccgcctcgcagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncagccccgtgccacctgtggtccacctgaccctgcgccaggccggc
gacgacttctcccgccgctaccggcgtttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacg
ctttgccacggtggtggaggagctcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtgggg
tcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaac
cggcatctgcacacctggatccaggacaacggaggctgggatgcctttgtggaactgtacggccccaccatgcagcctct
gtttgacttctcctggctgtctctgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatc
tgggccataagtga
>gnl|bcl2dbcds|Q6R755_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=711 residues).
atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatacattataagctgtcacagagggg
ctacgagtgggatgtgggagatgtggacgccgcgcccctgggcgccgcccccacccctggcatcttctccttccagcctg
agagcaacccaacgcccgctgtgcaccgggacatggctgccaggacatcgccactaaggcccatagtcgccaccactggg
cctacccttagccccgtgccacctgtggtccacctgaccctccgccgggctggggatgacttctcccgtcgctaccgtcg
cgacttcgcggagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagc
tcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
cgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggacaacggaggctgggatgcctttgtggaactgtacggccccaccatgcagcctctgtttgatttctcctggctgtctc
tgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|Q75SV7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=720 residues).
atggcgcacgctgggcgaacagggtacgataaccgggagatagtgatgaagtacatccactacaagctgtcgcagagggg
ctacgagtgggacgcgggagaggcgggcgccgcgcccccgggggccgcccccgcgccgggcatcttctcctcgcagcccg
gccgcgcccccgcgcccgccaggacctcgccgcccccgccccccgccgcccccgctgccgccgccgccgccgccgccgac
gccgcgggccccgcgcccagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtgg
tggaggagctcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacac
ctggatccaggacaacggaggctgggatgcctttgtggaactgtacggccccaccatgcagcctctgtttgacttctcct
ggctgtctctgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A076FU27_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Capra hircus GN=BCL-2 (length=690 residues).
atggcgcacgcggggggcacaggctacgataaccgcgagatcgtgatgaagtacatccactacaagctgtcgcagcgcgg
ctacgagtgggatgccagagccgcgggcgccgcgccccccggggccgcccccgcgccgggcatcctgtcctcccagccgg
gccgcacacccgcgccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgcca
cctgtggtccacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
ccagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatatgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacgcctggatccaggacaacggaggctgggacgc
ctttgtggagctgtacggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctgg
ccctggtgggcgcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A076FZV9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Capra hircus GN=BCL-2 (length=690 residues).
atggcgcacgcggggggcacaggctacgataaccgcgagatcgtgatgaagtacatccactacaagctgtcgcagcgcgg
ctacgagtgggatgccggagccgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcctcccagccgg
gccgcacacccgcgccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgcca
cctgtggtccacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
ccagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacgcctggatccaggacaacggaggctgggacgc
ctttgtggagctgtacggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctgg
ccctggtgggcgcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|H0W1T3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cavia porcellus GN=BCL-2 (length=549 residues).
atggctcacgctgggagaacagggtatgataaccgggaaatagtgatgaagtacatccactataagctgtcccagagagg
ctacgagtgggatgccggagacgggagcgcactgggtcgcaactccccgcttggtgtgccccgggacccggccgccagga
cctcgccaccgccacccctggccggcctcgccgtcgcccaggggcctgcgctcagcccggtgccacctgtggtccacctg
accctccgccaggccggcgatgacttctcccgccgctatcgccaagacttcgctgagatgtccagccagctgcacctgac
gcctttcaccgcgaggggacgctttgccacgctcttcagggatggggtgaactgggggaggattgtggccttctttgagt
tcggtggggtcatgtgtgtggagagtgtcaaccgggagatgtcacctctggtggacaacatcgccctctggatgactgag
tacctgaaccggcacctgcacacctggatccaggataacggaggatgggtaggtgcatgtttgagtgag
>gnl|bcl2dbcds|A0A2K5NZS5_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cercocebus atys GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggcgcggcgacccctggggtcgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggacgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A0D9S017_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Chlorocebus sabaeus GN=BCL-2 (length=717 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggcgccgcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggacgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaag
>gnl|bcl2dbcds|A0A2K5HK49_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggagccgcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgcggggcctgcgcttagcccagtgccacctgtggtccaccttaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgtggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A0U3DHY6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Coregonus lavaretus GN=BCL-2 (length=684 residues).
atggcaaacgagaatccttatgacagtcgctttattgtcgaaaaatacatccataacaaactgttgaagaagggatttgt
atgggaatttcaagcagaaaacgattctccaaataatttatttggggacccctctacacccaacacccccgaagtttttg
cacggaggtcccagcccaccgccgcggtcgaggacaccgactctcctttccaaaacaggagtccgcaaccggacccacat
gtcaggctccacagggtcctgcgcgaggcgggggacgagattgaaagaatgtatctgcgggactttgcagagatgtcggg
gcaattgcattttacgcccagcacggcacaganaaggtttaccgctgtaatagatgagctcttcagcgacggggtaaact
ggggtcggattgtggctttctttgagtttggagggacaatgtgcgtggagagcgtcaaccgggagatgacgtcccaggtg
gacaacatcgctctttggatgacggagtacctgaacggacccctacagaactggatccaggagaatggtggctgggacgc
ctttgtggagatctatgaacagcagaggatctctcactcctggccgtacctaaagacagtgttcggcctggccgccctgg
gagccgtcggagtcaccatcggagccttgttcacccagaagtga
>gnl|bcl2dbcds|Q9JJV8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cricetulus griseus GN=BCL-2 (length=711 residues).
atggctcaagctgggagaacagggtatgataaccgagagatcgtgatgaagtacatccattataagctgtcacagagggg
ctacgagtgggatgtgggagatgtggacgccgcgcccctgggcgccgcccccacccctggcatcttctccttccagcctg
agagcaacccaacgcccgctgtgcaccgggacatggctgccaggacatcgccactaaggcccatagtcgccaccactggg
cctacccttagccccgtgccacctgtggtccacctgaccctccgccgggctggggatgacttctcccgtcgctaccgtcg
cgacttcgcggagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgctacggtggtggaggaac
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcacccctggtggacaacatcgccctgtggatgaccgagtacctgaaccggcatctgcacacctggatcca
ggataacggaggctgggacgcatttgtggaactgtacggccccagtgtgaggcctctgtttgatttctcttggctgtctc
tgaagaccctgctcagcctggccctggtcggggcctgcatcactctgggtacctacctgggccacaagtga
>gnl|bcl2dbcds|Q923R6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cricetulus longicaudatus GN=BCL-2 (length=711 residues).
atggctcaagctgggagaacagggtatgataaccgagagatcgtgatgaagtacatccattataagctgtcacagagggg
ctacgagtgggatgtgggagatgtggacgccgcgcccctgggcgccgcccccacccctggcatcttctccttccagcctg
agagcaacccaacgcccgctgtgcaccgggacatggctgccaggacatcgccactaaggcccatagtcgccaccactggg
cctacccttagccccgtgccacctgtggtccacctgaccctccgccgggctggggatgacttctcccgtcgctaccgtcg
cgacttcgcggagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgctacggtggtggaggaac
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcacccctggtggacaacatcgccctgtggatgaccgagtacctgaaccggcatctgcacacctggatcca
ggataacggaggctgggacgcatttgtggaactgtacggccccagtgtgaggcctctgtttgatttctcttggctgtctc
tgaanaccctgctcaacctggccctggtcggggcctgcatcactctgggtacctacctgggccacaagtga
>gnl|bcl2dbcds|X4ZGI8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyprinus carpio GN=BCL-2 (length=690 residues).
atggccaacgaaattcgctatgacaatcggaatattgtggagaaatacctcaatcacaaactttcaaagaagggatatga
gtggaaatttcaatcttccggggaggatgatgacactatcaatacgggagtggaggactcctctccgagctctgacagga
ggctccaggctccctcagccggagggggaaacaactctgaatgcctgatagcaaaccgggtcacacgttcagacccttat
tcgaggatctaccgatcgttacgcgaggctggagaccagatagaaaggatgtaccagcgtgaatttgaggagatgtccca
ccagatgacattcagtcccagtgcagcacaacgcagcttcttagctgtggctgaagagctcttcagagacggagtgaact
gggggcggatcgtcgctttctttgagtttggtgggaccatgtgtgtggagagcttcaaccgggagatggcgtcccaggta
gataatattgcacactggatgacagactacctgaacgggccactggaaaactggatcgaggaaaatggaggctgggacgc
ctttgtggagttatacagtcagcagagagaccctatgttccacccattgtcgtacctaacgaaagtgcttggattggcag
cactaggcttggcaggagtgaccatcggagcctttttcgctcagaagtga
>gnl|bcl2dbcds|Q564A4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Danio rerio GN=BCL-2 (length=687 residues).
atggctaacgaaattagctatgacaatcggaatattgtggagaaatacctcaagcataaactttcaaagcgaggatatgt
gtggaaatgtcagtcctctgctgaggaagatgacaccttcaataaagcagtggaggaatcctctccaaactctgacagga
ggcttcaggctccctcagccggcggagggaacaactctgaatgcctgatagcccgggtcactcgttcagaccctcatttg
aggctctaccgggtgttacgggatgctggagatgaaatagaaaggatttaccaacgcgaatttgaggaaatgtcccaaca
aatggtgttcaacccaaattctgcgcaacgcagctttctaaccgtggccgaagagctctttagagacggagtgaactggg
ggcggatcattgcattcttcgagtttggtgggaccatgtgcgtggaaagcgtcaaccgggagatggcgtcccaggtagat
aatattgcacactggatgactgactacctgaacgggccactggaaaactggatcgaggaaaatggaggttgggatgcctt
cgtggagatgtacggtcagcagagagactctgtgttccacccgttttcatacctaacaaaagtgctcggcttggcggcgc
tgggcttggcaggagtgaccatcggagccttttttgctcagaagtga
>gnl|bcl2dbcds|A0A1X9JZA1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Dicentrarchus labrax GN=BCL-2 (length=687 residues).
atggcgaacgagtgtaatcgcaacattgtggaaaagtatatctgccataaactctccaaacagggctacgagtgggggtt
tgacgctgtccggaatgcagatgccggtaataatgggtcaatagttgcccctccaccgagtttggtccgccggtgccgtg
gagccagcaccgggcccgacagcgagagcatcccccacctctgcacacggctcccccagtccgacccgcatgccgccatc
cacagagtcctacgcgaggctggagacgaacttgaaagactgtaccagccggacttcacggagatgtcgcggcagctgta
tctcacctccaccacggcgcagaggagattcgccgacgtgatagacgaactgttccgggacggggtgaactggggccgga
ttatcgctttcttcgagttcgggggcacggtgtgcgtggagtgcgtggcgaaggaggagatggcagcgcaggtgaacaac
atcgcggagtggatgactgagtatttaaatggacctctgaacagctggatacaagataacgggggatgggatgcctttgt
ggagctgtatgacagacagagggactccgtcttcagttgctcctggccctccattaagacggtcttcggtgtggctgcgc
ttggagcagctagcctcaccatcggagcgtaccttacacagaagtga
>gnl|bcl2dbcds|F7CDX6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Equus caballus GN=BCL-2 (length=699 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcgggcgccgcgcccctgggggccacccccgtgccgggcatcttctcctcccagcccg
ggcgcacccccgcgcccgccaggacctccccgctgctacccccggccgcccccgccggcgccgcgggacctgccctcagc
cctgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgactttgccga
gatgtccagccagctgcacctgacgcctttcaccgcaaggggacgctttgccacggtagtggaggagctcttcagggatg
gggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcg
cccctggtggacaacatcgccctgtggatgactgaatacctgaaccggcacctgcacacctggatccaggataacggagg
ctgggacgcctttgtggaactgtacggccccagcatgcggccgctgtttgatttctcctggctgtctctgaaggcgctgc
tcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|M3X1R9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Felis catus GN=BCL-2 (length=714 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtcatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggggacgcgggcgccgcgcccccgggggccgcccccgcgccgggcatcttctcctcccagcccg
ggcgcacccctgcgcccgccaggacctccccgccgccgcccccggtcgcccccgccgccgccgccgccgccgccgccgcg
ggccctgcgctcagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccg
ccgcgacttcgcggagatgtccagccagctgcacctgacaccctttaccgcaaggggacgctttgccacggtggtggagg
agctcttcagggatggagtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtc
aaccgagagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggat
ccaagacaacggaggctgggatgcctttgtggaactgtacggccccagcatgcagcctctgtttgatttctcctggctgt
ccctgaaggccctgctcagtctggccctggtgggggcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|U3KEW4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ficedula albicollis GN=BCL-2 (length=720 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccggcgagcacagggcacccctgcctccaggtctctctgctcctgctgctgctgcggttgctgctg
ctgctgggacttcctctgatcacactgggccggtgtctccgcaccccgagccccccggctcggctgctgctagccccgcg
cccccggccgaggggctgcgccccgcaccccaggtcgtccacctggtcctgcgccaggcgggcgacgagttctcccggcg
ctaccagagggactttgcccaaatgtctggccagctgcacctgacgcccttcacggccaggagccgcttcgtggccgtgg
tggaggagctcttccgagacggggttaactggggcagaatcgtggccttcttcgagtttggcggcgtgatgtgcgtggag
agcgtcaacagggagatgtctccgctggtggacagcatcgccgcctggatgaccgagtacctgaaccggcacctgcacaa
ctggatccaggacaacggaggctgggatgcctttgtggagttgtatggcaacagtatgaggcctttgttcgatttctcct
ggatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatctcggacataagtag
>gnl|bcl2dbcds|Q00709_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Gallus gallus GN=BCL-2 (length=702 residues).
atggctcaccccgggagaagaggctacgacaaccgcgagatagtgctgaagtacatccactataaactctcgcagcgggg
ctacgactgggccgccggcgaggacaggccgcccgtgcccccggccccggctcccgctgctgctcccgctgcggtggctg
ctgctggagcctcctcccaccaccgccccgagccccccggctcggctgctgctagtgaggtgcccccggctgaggggctg
cgccccgcgcctcccggcgtccacctcgccctgcgccaggccggggacgagttctcgcgccgctaccagagggacttcgc
ccagatgtcgggccagctgcacctgacgcccttcacggcccacggccgcttcgtggccgtggtggaggagctcttccgtg
atggggtcaactggggccggatcgtcgccttcttcgagttcggcggcgtgatgtgcgtcgagagcgtcaaccgggagatg
tcgccgctggtggacaacattgccacctggatgaccgagtacctgaaccggcacctgcacaactggatccaggacaacgg
aggatgggatgcctttgtggaattgtacggcaacagtatgaggcctttgttcgatttctcctggatctctctgaagacca
tcctgagcctggttctggtgggagcttgcatcactcttggcgcttatcttggacataagtag
>gnl|bcl2dbcds|Q00709_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Gallus gallus GN=BCL-2 (length=699 residues).
atggctcaccccgggagaagaggctacgacaaccgcgagatagtgctgaagtacatccactataaactctcgcagcgggg
ctacgactgggccgccggcgaggacaggccgcccgtgcccccggccccggctcccgctgctgctcccgctgcggtggctg
ctgctggagcctcctcccaccaccgcccgagccccccggctcggctgctgctagtgaggtgcccccggctgaggggctgc
gccgcgcctcccggcgtccacctcgccctgcgccaggccggggacgagttctcgcgccgctaccagagggacttcgccca
gatgtcgggccagctgcacctgacgcccttcacggcccacggccgcttcgtggccgtggtggaggagctcttccgtgatg
gggtcaactggggccggatcgtcgccttcttcgagttcggcggcgtgatgtgcgtcgagagcgtcaaccgggagatgtcg
ccgctggtggacaacattgccacctggatgaccgagtacctgaaccggcacctgcacaactggatccaggacaacggagg
atgggatgcctttgtggaattgtacggcaacagtatgaggcctttgttcgatttctcctggatctctctgaagaccatcc
tgagcctggttctggtgggagcttgcatcactcttggcgcttatcttggacataagtag
>gnl|bcl2dbcds|G3QES9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgagagatagtgatgaagtacatccattataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgtgcccccgggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatccagccgcatcccgggaccgggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtctcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A9QXG9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Homo sapiens GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacggggtacgataaccgggagatagtgatgaagtacatccattataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgcccccgggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatccagccgcatcccgggacccggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgagccacaagtga
>gnl|bcl2dbcds|I3MVK9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL-2 (length=588 residues).
atggctcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcacagagggg
ctacgagtgggatgctggagacgtgggcgctgcgtccccaggagccgcccccgggccgggcatcttctcttcccaaccgg
ggagccataccccggccgccaggacctcgccaccgccacccccggctgcccccgctgccgccgcggggcccgtgctcagc
ccggtgccacctgtggtccacctgaccctccgccaggccggcgatgacttctctcgtcgctatcgtcgcgacttcgccga
gatgtccagtcagctgcacctgacgcccttcaccgcaaggggacgctttgccacggtggtggaggagctcttcagggatg
gggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcg
cccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggataacggagg
ctgggtaggtgcacgtcgggttgaatga
>gnl|bcl2dbcds|W5N4F7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Lepisosteus oculatus GN=BCL-2 (length=696 residues).
atggcaaataacgaagccccgtacgatactcggaatatcgtgacaaaatacatccatcacaaactcctgaagaagggcta
cgtgtgggaatcccgcgtgtccggcgagaccgatccccccaataacggattggtgggcccctccgcctcgggtccggggc
tgcaggcgcggcggctccaggctgccggggccgagcgcggagctgtcccggtcccccgccggacccccccgcccgacccc
cacgccgctctccacaaggtgctgcgggaggctggggacgagatcgagaggatgtaccaccgggacttcgcggagatgtc
ggatcagttgcacttcacccccaacaccgcccggaggaagttcaccgcggtggtggaggagctgtttcgggacggagtca
actgggggcggattgtcgctttcttcgagttcggcgggacgatgtgcgtggagagcgtgaaccgggagatgacgtcccag
gtggacaacattgccaactggatgacggagtatctcaacgggccccttcagaactggatccaggagaacggaggctggga
cgcctttgtggagctctatgggagacagagaggctccatgttcagctgttcatggccatctttgaagactttctttggtc
tagctgctctgggcgcagcaggcctgaccgttggagcctactttacacaaaaatga
>gnl|bcl2dbcds|G3ULB7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Loxodonta africana GN=BCL-2 (length=690 residues).
atggcgcacgcagggagaacaggttatgacaaccgggagatagtgatgaagtatatccactataagctgtcgcagcgggg
ctacgaatgggaggctggcgaagctagcgccgcgccccccggggccgctcccgcgccgggcgtcctctcttctccgcccg
cggcgccccggggcccggacaccaggacctcgccgctccaggctgacccggccgcgcagccggcgctcagcccggtgcca
cctgtagttcacctgaccttgcgccaggccggcgacgacttctccaggcgctaccgccgcgacttcgccgagatgtcgag
ccagctgcacctgactcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttcagggacggggtgaact
gggggcggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacaacatcgccctctggatgactgagtacctgaaccggcacctgcacacctggatccaggataacggaggatgggatgc
ctttgtggaactgtatggccccaacatgcgacctctgtttgatttctcctggctgtctctgaagacactgctcagtctgg
ccctggtgggagcttgcatcaccctgggtgcttacctggggcacaagtga
>gnl|bcl2dbcds|G3ULB7_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Loxodonta africana GN=BCL-2 (length=504 residues).
atggcgcacgcagggagaacaggttatgacaaccgggagatagtgatgaagtatatccactataagctgtcgcagcgggg
ctacgaatgggaggctggcgaagctgacaccaggacctcgccgctccaggctgacccggccgcgcagccggcgctcagcc
cggtgccacctgtagttcacctgaccttgcgccaggccggcgacgacttctccaggcgctaccgccgcgacttcgccgag
atgtcgagccagctgcacctgactcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttcagggacgg
ggtgaactgggggcggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgc
ccctggtggacaacatcgccctctggatgactgagtacctgaaccggcacctgcacacctggatccaggataacggagga
tgggtaggtgcatgtgtggttgaa
>gnl|bcl2dbcds|A0A2K5UDI5_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Macaca fascicularis GN=BCL-2 (length=729 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggcgcggcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgccgccgccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgactt
ctcccgccgctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttg
ccacggtggtggaggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatg
tgtgtggagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggca
cctgcacacctggatccaggataacggaggctgggacgcctttgtggaactgtacggccccagcatgcggcctctgtttg
atttctcctggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggc
cacaagtga
>gnl|bcl2dbcds|A0A1D5QRF2_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Macaca mulatta GN=BCL-2 (length=750 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggcgcggcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgccgccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctc
ccgccgctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgcca
cggtggtggaggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgt
gtggagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacct
gcacacctggatccaggataacggaggctgggtaggtgcacttggtgatgtgagtctgggctggggccacaggttcgagg
tgcgggggttggagtgcgggtgggctcctggggcaaggggaggctgtggagccggcgaaataaaatcagggttgttgctt
cccggcgtccctacctcttcctctggataa
>gnl|bcl2dbcds|A0A2K6CIX3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Macaca nemestrina GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggcgcggcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggacgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A2K5XRD4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggcgcggcgacccctggggtcgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccactgccgaccccggctgcccccgccgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggacgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|G1MZW1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Meleagris gallopavo GN=BCL-2 (length=318 residues).
gtggaggagcttttccgtgatggggtcaattggggccggatcgtcgccttctttgagttcggcggcgtgatgtgcgtcga
gagcgtcaaccgggagatgtcgccgctggtggacaacattgccacctggatgaccgaatacctgaacaggcacctgcaca
actggatccaggacaacggaggatgggatgccttcgtggaattgtacggcaccagtatgaggcctttgtttgatttctcc
tggatctctctgaagaccatcctgagcctggttctggtgggagcttgcatcactcttggcgcttatcttggacataag
>gnl|bcl2dbcds|F6YNL8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Monodelphis domestica GN=BCL-2 (length=771 residues).
atgatggctcaccctggaagaagaggatatgataaccgggagatagtgatgaaatacattcattataaactgtcacagag
ggggtacgagtgggatgctggagatctgagggcaccagcctctccaagtcttcctcctgttgttgcttctgcccctgctg
ttggaatcttctctacccagccacgaaacacaccattgcctgctgaaccccaggactcggccacttctactactgctgct
gctagaaactcacctttgcctcttcctcctcctgctgttgctgctgctgctgctgctggacctaccgtcagtccagtgcc
acctgtggtccacctgactcttcgtcaagctggagatgatttctctagaaggtaccggagagactttgatgaaatgtcag
gtcaactgcacctgacccctgttactgctaggggacgctttgccacagtggtagaggagctgttcagggatggggtgaac
tgggggaggatcgtggccttctttgagtttggtggtgttatgtgtgtggagagcgtcaaccgggagatgtcgcccctggt
ggacagcattgccctatggatgactgagtacctgaaccggcacctgcacacttggatccaggataacggaggatgggatg
cctttgtggaattgtatggcaacagcatgaggcctttgttcgatttctcctggctgtctctgaagactcttctcagcctg
gctctggtgggagcttgtgtcactcttggtgcctacctgggacacaaatga
>gnl|bcl2dbcds|P10417_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mus musculus GN=BCL-2 (length=600 residues).
atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatacattataagctgtcacagagggg
ctacgagtgggatgctggagatgcggacgcggcgcccctgggggctgcccccacccctggcatcttctccttccagcctg
agagcaacccaatgcccgctgtgcaccgggacatggctgccaggacgtctcctctcaggcccctcgttgccaccgctggg
cctgcgctcagccctgtgccacctgtggtccatctgaccctccgccgggctggggatgacttctctcgtcgctaccgtcg
tgacttcgcagagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggaac
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcacccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggataacggaggctgggtaggtgcatgtctggttgaatga
>gnl|bcl2dbcds|P10417_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mus musculus GN=BCL-2 (length=711 residues).
atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatacattataagctgtcacagagggg
ctacgagtgggatgctggagatgcggacgcggcgcccctgggggctgcccccacccctggcatcttctccttccagcctg
agagcaacccaatgcccgctgtgcaccgggacatggctgccaggacgtctcctctcaggcccctcgttgccaccgctggg
cctgcgctcagccctgtgccacctgtggtccatctgaccctccgccgggctggggatgacttctctcgtcgctaccgtcg
tgacttcgcagagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggaac
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcacccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggataacggaggctgggatgcctttgtggaactatatggccccagcatgcgacctctgtttgatttctcctggctgtctc
tgaagaccctgctcagcctggccctggtcggggcctgcatcactctgggtgcatacctgggccacaagtga
>gnl|bcl2dbcds|M3YYK3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mustela putorius furo GN=BCL-2 (length=621 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
aagaccagtgatgaaactcgtgtacttacccaccgccccccccccaccccccctctcccgccaccgccgcccgcagctca
cctccccggccaccgccctcgccgccgctgccgccgcgggccctgcgctcagccccgtgccacctgtggtccacctgacc
ctgcgccaggccggcgacgacttctcccgtcgctaccgccgcgacttcgcggagatgtccagccagctgcacctgacgcc
cttcaccgcgaggggacgctttgccacggtggtggaggagctcttcagggatggggtgaactgggggaggattgtggcct
tctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctatgg
atgactgagtacctgaaccggcacttgcacacctggatccaggacaacggaggctggcctgcccccgccccccatgaagg
tccagctgccagacctattgttgatgattcctactggcccaaagtgttttccttgcttgcc
>gnl|bcl2dbcds|A0A2I3GZF9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccattataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgcccccgggggccgcccccgcaccgggcatcttctcctcccagccgg
ggcacacgccccatccagctgcatcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccggcgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgatgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|G1TW27_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BCL-2 (length=681 residues).
atggcgcacgccgggcgaacagggtacgacaaccgggagatcgtgatgaagtacatccactataagctgtcccagagggg
ctacgagtgggacgctggggacgcgggcgccgcctccgcgccgggcgtcttctcctcccagcccgcgcccgctgcgcccc
gggacccggccgccaggacctcgccgccgccgccgccggccgccgcggggcccgcgctcagcccggtgccacctgtggtc
cacctgaccctccgccaggcgggcgacgacttctcccggcgctaccgccgcgacttcgcggagatgtccagccagctgca
cctgacgccctttcacgcgagggggcgctttgccacggtggtggaggagctcttcagggatggggtgaactgggggagga
ttgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggacaacatc
gccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggataatggaggctgggatgccttcgtgga
actgtacggccccagcgtgcggcctctgtcagacttctcctgggtgtctctgaagactttgttcagcctggccctgatag
gagcttgcatcaccctcggtgcctacctgggccacaagtga
>gnl|bcl2dbcds|H0WKI0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Otolemur garnettii GN=BCL-2 (length=717 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgctggagacgtgggcgttgcaccccccggggccgccactgcgccgggcgtcttctcctcccagcccg
ggcgcacccctactcccgctgcgccccgggacccggccgccaggacctcgcccccggccgcccccgccgccgccgccgcc
gcggagcctctgctcagcccggtgccacctgtggtccacctgaccctccgccaggcgggcgatgacttctctcgccgcta
ccgccgcgacttcgccgagatgtccagccagttgcacctgacgcccttcaccgcgagaggacgctttgccacggtggtgg
aggagctcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggagagc
gtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctg
gatccaggataacggaggctgggacgcctttgtggaattgtatggccccagcatgcggcctctgtttgacttctcctggc
tgtctctgaagaccctgctcagcctggccctggtgggagcttgcatcaccctgggtgcctacctgggccacaagtga
>gnl|bcl2dbcds|A0A2R9APW6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Pan paniscus GN=BCL-2 (length=582 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccattataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgcccctcagcccggtgccacctgtggtccacctgaccctccgccagg
ccggcgacgacttctcccgccgctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcg
cggggacgctttgccacggtggtggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagtt
cggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagt
acctgaaccggcacctgcacacctggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatg
cggcctctgtttgatttctcctggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctggg
tgcctatctgggccacaagtga
>gnl|bcl2dbcds|H2QEM8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Pan troglodytes GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccattataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgcccccgggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatccagccgcatcccgggacccggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A096MPU7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Papio anubis GN=BCL-2 (length=717 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatggcgcggcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccgggc
acacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgccgcc
gcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccgcta
ccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtggtgg
aggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggagagc
gtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctg
gatccaggataacggaggctgggacgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcctggc
tgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|K7F5Y4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Pelodiscus sinensis GN=BCL-2 (length=699 residues).
atggctcatcctgggagaagaggctatgataaccgggagatagtgttgaagtacatccattacaaactgtcacagagggg
gtatgattgggctgccaatgaaaacagaggaccagtttcttcaagtctctctcctcctgctgctgggaccccatctgacc
atgctgggctggtgtctttgccgcctgaaccccctggttcggctgctgctagtaatgtgccccttggtgatgggctgcgc
tcagcaccacaggctgttcacttgactctgtgccaagccggagatgaattttcccgccgctatcacagagattttgccca
gatgtctgggcagctgcacttgaccccattcacggccagggggcgctttgtggcggtggtggaggagctattccgagatg
ggattaactggggaaggatcgtggccttctttgaatttggtggcgtgatgtgtgtggagagtgtcaaccgggagatgtcg
cctcttgtggacagtattgctgtgtggatgactgagtacctgaacagacacttgcacaactggatccaggacaatggagg
ttgggatgcctttgtggaattgtatggcagcaacatgaggcctttgtttgatttctcctggatctctttgaagactatcc
tcagtcttgctctggtgggagcttgcatcacccttggagcttatctgggacataagtga
>gnl|bcl2dbcds|K7F5Y4_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Pelodiscus sinensis GN=BCL-2 (length=513 residues).
atggctcatcctgggagaagaggctatgataaccgggagatagtgttgaagtacatccattacaaactgtcacagagggg
gtatgattgggctgccaatgaaaacagaggaccagtttcttcaagtctctctcctcctgctgctggttcggctgctgcta
gtaatgtgccccttggtgatgggctgcgctcagcaccacaggctgttcacttgactctgtgccaagccggagatgaattt
tcccgccgctatcacagagattttgcccagatgtctgggcagctgcacttgaccccattcacggccagggggcgctttgt
ggcggtggtggaggagctattccgagatgggattaactggggaaggatcgtggccttctttgaatttggtggcgtgatgt
gtgtggagagtgtcaaccgggagatgtcgcctcttgtggacagtattgctgtgtggatgactgagtacctgaacagacac
ttgcacaactggatccaggacaatggaggttgg
>gnl|bcl2dbcds|K7F5Y4_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Pelodiscus sinensis GN=BCL-2 (length=585 residues).
atggctcatcctgggagaagaggctatgataaccgggagatagtgttgaagtacatccattacaaactgtcacagagggg
gtatgattgggctgccaatgaaaacagaggaccagtttcttcaagtctctctcctcctgctgctgggaccccatctgacc
atgctgggctggtgtctttgccgcctgaaccccctggttcggctgctgctagtaatgtgccccttggtgatgggctgcgc
tcagcaccacaggctgttcacttgactctgtgccaagccggagatgaattttcccgccgctatcacagagattttgccca
gatgtctgggcagctgcacttgaccccattcacggccagggggcgctttgtggcggtggtggaggagctattccgagatg
ggattaactggggaaggatcgtggccttctttgaatttggtggcgtgatgtgtgtggagagtgtcaaccgggagatgtcg
cctcttgtggacagtattgctgtgtggatgactgagtacctgaacagacacttgcacaactggatccaggacaatggagg
ttgggctggtgcagtgagcgttctc
>gnl|bcl2dbcds|H2NWH5_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Pongo abelii GN=BCL-2 (length=717 residues).
atggcgcacgctgggacaacagggtacgataaccgggagatagtcgatgaaancatccattataagttgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgcccccgggggccgccaccgcacccggcatcttctcctcccagcccg
ggcacacgcctcatccagccgcatcccgggacccggccaggacctcgccgctgccgaccccggctgcccctggcgccgcc
gtggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccgccgcta
ccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtggtgg
aggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagc
gtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctg
gatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcctggc
tgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A2K6G3I7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Propithecus coquereli GN=BCL-2 (length=705 residues).
atggcgcacgccgggagaacagggtatgataaccgggagatagtgatgaagtacatccattataagctggcgcagagggg
ctacgagtgggatgccggagacgcgggcgctgcgcccccgggggccgcccccacgccgggcatcttctcctcccagcccg
ggcgcaacccccctcccgctgcgcctcgggacccggccgccaggacctcgcccccgcccgccgccgccgcggggcctgcg
cccagcccggtgccacctgtggtccacctgaccctccgccaggcgggcgatgacttctcccgccgctaccgccgcgactt
cgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttca
gggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggag
atgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggataa
cggaggctgggacgcctttgtggaattgtatggtcccagcatgcggcctctgtttgatttctcctggctgtctctgaaga
ctctgctcagcctggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|F1LNV0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Rattus norvegicus GN=BCL-2 (length=711 residues).
atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatccattataagctgtcacagagggg
ctacgagtgggatactggagatgaagactccgcgcccctgagggctgcccccacccctggcatcttctccttccagcctg
agagcaaccggacgcccgctgtgcaccgagacacggctgccaggacgtcgcctctacggccccttgtcgccaccgctggg
cctgcgctcagccctgtgccacctgtggtccacctgaccctccgccgggctggggatgacttctctcgtcgctaccgtcg
cgactttgcagagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggaac
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcacccctggtggacaacatcgctctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggataacggaggctgggatgcctttgtggaactatatggccccagcatgcgacctctgtttgatttctcctggctgtctc
tgaagacgctgctcagcctggccctggtgggggcctgcatcactctgggtgcatacctgggccacaagtga
>gnl|bcl2dbcds|P49950_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Rattus norvegicus GN=BCL-2 (length=711 residues).
atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatccattataagctgtcacagagggg
ctacgagtgggatactggagatgaagactccgcgcccctgagggctgcccccacccctggcatcttctccttccagcctg
agagcaaccgaacgcccgctgtgcaccgagacacggctgccaggacgtcgcctctacggccccttgtcgccaacgctggg
cctgcgctcagccctgtgccacctgtggtccacctgaccctccgccgggctggggatgacttctctcgtcgctaccgtcg
cgactttgcagagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggaac
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggggagcgtcaac
agggagatgtcacccctggtggacaacatcgctctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggataacggaggctgggatgcctttgtggaactatatggccccagcatgcgacctctgtttgatttctcctggctgtctc
tgaagacgctgctcagcctggccctggtgggggcctgcatcactctgggtgcatacctgggccacaagtga
>gnl|bcl2dbcds|Q7TSN8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Rattus norvegicus GN=BCL-2 (length=711 residues).
atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatacattataagctgtcacagagggg
ctacgagtgggatgctggagatgcggacgcggcgcccctgggggctgcccccacccctggcatcttctccttccagcctg
agagcaacccaatgcccgctgtgcaccgggacatggctgccaggacgtctcctctcaggcccctcgttgccaccgctggg
cctgcgctcagccctgtgccacctgtggtccatctgaccctccgccgggctggggatgacttctctcgtcgctaccgtcg
tgacttcgcagagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggaac
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcacccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggataacggaggctgggatgcctttgtggaactatatggccccagcatgcgacctctgtttgatttctcctggctgtctc
tgaagaccctgctcagcctggccctggtcggggcctgcatcactctgggtgcatacctgggccacaagtga
>gnl|bcl2dbcds|A0A2K6KHG1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Rhinopithecus bieti GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ttggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A2K6R2I6_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL-2 (length=627 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ttggatccaggataacggaggctggcgtacaatgtgcacgtggtgccgcttcaggggatgtgattga
>gnl|bcl2dbcds|A0A2K6R2I6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ttggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A2K6UEL3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagatgtgggcgccgcgcccccaggcgccgcccccgcgccgggcatcttctcctcccagcccg
ggcacacgcccggtcccgctgcgccccgggaccctgtcgccaggaccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnncagcccagtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccgccg
ctatcgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgaccgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggaactgtatggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagcttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|G3WZW9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sarcophilus harrisii GN=BCL-2 (length=684 residues).
atggctcaccctggaagaagaggatatgataaccgggaaatagtgatgaaatacattcattataagctatcacagagagg
gtacgagtgggatgctggaaatctgaggacaccagcctctccaagtcttcctcctgttgttgcttctgcccctgctgttg
gaatcttctctaaccagccaagacatacacctctgcctgctgcaccccaggacttggccacttctactactgctgctgct
agaaactcacctttgcctcctcctcctgctgttgctgctgctactgttgctgctggaccagctgtcagtccagtgccacc
tgtggtccacctgactcttcgtcaagctggagatgatttctctcgaagatatcgaagagatttcgatgaaatgtcaggtc
agctgcacctgacccctgttactgctaggggacgctttgccacagtagtggaagagctgttcagggatggggtgaactgg
gggcggattgtggccttctttgaatttggtggtgttatgtgtgtggagagcgtcaaccgggagatgtcgcctctggtgga
cagcatagccctgtggatgactgagtacctgaaccggcacctgcacaactggatccaggataacggaggatggggtacca
aagcaatttgcatgggcaccagtggtccatttcaggtaagttaa
>gnl|bcl2dbcds|G3WZW9_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sarcophilus harrisii GN=BCL-2 (length=498 residues).
ccatttggctgctctccttggtgttcactgctctctcctttgggaataatggctcaccctggaagaagaggatatgataa
ccgggaaatagtgatgaaatacattcattataagctatcacagagagggtacgatgttgctgctggaccagctgtcagtc
cagtgccacctgtggtccacctgactcttcgtcaagctggagatgatttctctcgaagatatcgaagagatttcgatgaa
atgtcaggtcagctgcacctgacccctgttactgctaggggacgctttgccacagtagtggaagagctgttcagggatgg
ggtgaactgggggcggattgtggccttctttgaatttggtggtgttatgtgtgtggagagcgtcaaccgggagatgtcgc
ctctggtggacagcatagccctgtggatgactgagtacctgaaccggcacctgcacaactggatccaggataacggagga
tgggtaggtgtttcggct
>gnl|bcl2dbcds|A0A287APJ6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sus scrofa GN=BCL-2 (length=1014 residues).
atgctgctgctggctgccgccttcctcgtggcgttcgtgctgctgctctacatggtgtctccgctcatcagccccaagcc
cctcgccctgcccggagctcatgtggtggttactggaggctccagcggcatcggaaagtgcattgccattgagtgctata
aacaaggagcgtttataactctggttgcacgaaatgaggacaagctgttgcaggcaaagaaagaaattgaaaaacactct
attaatgataaacaggtggtgctttgtatatcagttgatgtgtctcaagactatagccaagtagagaatgtcataaaaca
agcacaggagaaactgggcccagtggacatgcttgtaaactgtgcaggaatgtcactttcaggaaaatttgaagatcttg
aagttagtacttttgagaggctcatgagtgtcaactacctgggcagcgtgtacccgagccgagcggtgatcaccaccatg
aaggagcgccgcgtgggcaggatcgtcttcgtgtcctctcaggccgggcagctgggcctgttcggcttcacagcctactc
ttcctcaaagtttgccatcaggggattggcagaagctctgcagatggaggtgaagccatataatgtttatgtcacagtgg
cctaccctccagacacagacacccctgggtttgccgaagaaaacaaaaccaagcctttggagactcgtcttatttcagag
accacatctgtttgcaaaccagagcaagtggccaaacaaattgttaaagatgccatacaaggaaatttcaatagttccat
cggctcagatgggtacatgctgtcctccctgacctgtggaatggctccagtaacttccatcactgaagggctccagcagg
atgcctttgtggagctgtatgggcccagcatgcggcctctatttgatttctcctggctgtctctgaaggcgctgctcagt
ctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A287APJ6_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sus scrofa GN=BCL-2 (length=717 residues).
atggcgcacgctgggagaacagggtatgataaccgggaaatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcgggcgccgcgtccccgggggccgctcccgcaccgggcatcttctcctcccagcccg
ggcgaacccccgctcccgccaggacctcgccgccgccgaccccgaccgcccccgccgccaccgccgccgccgccgccgcc
gcggggcctgtactcagcccggtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctctcgtcgcta
ccgccgcgactttgccgagatgtccagccagctgcacctgactcccttcaccgcgaggggacgctttgccacggtggtgg
aggagctcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagc
gtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctg
gatccaggataacggaggctgggatgcctttgtggagctgtatgggcccagcatgcggcctctatttgatttctcctggc
tgtctctgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|H0YUX3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Taeniopygia guttata GN=BCL-2 (length=729 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctctcagagggg
atacgactgggctgccggcgaggacagggcatccctgcctccagatcactccgcttctgctgctgctgcgattgctgctg
ctgcgattgctgctgctgggacttctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctactgct
agccacacgcccccagccgaggggctgcgccctgcaccccaggccgtccacctcgtcctgcgccaggcgggggatgagtt
ctcccgacgctaccagagagacttttcccaaatgtctggccagctgcacctgacgccctttacagccaggagccgcttcg
tggcggtggtggaggagctcttccgagatggggttaactggggcagaattgtggccttcttcgagtttggcggtgtgatg
tgtgtggagagcgtcaacagggagatgtttcccctcgtggacaacattgccacctggatgactgagtacctgaaccggca
cctgcacaactggatccaggacaacggaggctgggatgcctttgtggagttgtatggcaacaatatgaggcctttgtttg
atttctcctggatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatcttgga
cataagtag
>gnl|bcl2dbcds|B9ZYL7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Xenopus laevis GN=BCL-2 (length=885 residues).
atggctcatcctagaagaggaggctatgatcaccgggacatagtggtaaaatatatccattataaactatctcagaaggg
gtatgcatgggaagagggaaggcagcaggtctctgctgagcaccctcaagcttctgctgctattagtaattattctgatg
atggagaaatgcctgctgcttccgcagattcacgtggaccacctcagtcttcactcgcatctgctgcttcctcagatgag
gaaaccccaagtaatactccaataacctttgtgggcaatgcacctgctgttcccaggaggtctgcatctgctgtttcacc
cttagctgaattgaatgtcgaaccaagagatcttaatgttaatccagatgccagtcgtgctgcagatggtgataataatg
atgctgatggtggtgatgaagctgttatgcagccagtcccttcggcagtgctacagaccttgagtcgagctggagatgag
ttctctcgcctatatcagcaagatttcagacagatctcagggctcctccatttaaccccatccacagttagggtgcgctt
tgcaacagtggtggaggagctctttcatgatggggtaaactggggaaggattgttgcttttttcgagtttggtggggtca
tgtgcgtggagattgttaaccgcgaaatgtctcctctggtggactccattgtgggttggatgacagagtacctaaaccgt
cacttacaaaattggatccaggaacaggatgcatttgtggagctgtacaacagcaatatccagccaccgtttgaccagag
ctggttatccatcaagacaatattaagccttgctgtggttggagcctgcatcacaatagggggcatatccttggccacca
aataa
>gnl|bcl2dbcds|F7BXJ7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Xenopus tropicalis GN=BCL-2 (length=573 residues).
atggctcatcctaggagaggaggctatgatcaccgggacatagtggtaaaatatatccattataaactgtctcaaaaggg
gtatgaatgggaagaggggcggcagcaggtctctgctgagcaccctcaagcttctgctgctattagtaattattctgatg
atggagaaatgcctgctgcttccgcagattcacgtggaccacctcaatcttcactcgcatctgctgctgcttcctcagca
gctatgcagccggtccctccagcagtgctacagaccttaagtcgagctggagatgagttctctcgcctctatcagcaaga
ttttagacagatctcagggctcctccatttaaccccatccacagttagggtgcgctttgcaacagtagtggaggagctct
ttcatgatggggtcaactggggaaggattgttgcttttttcgagtttggtggggtcatgtgcgtggaaagtgttaatcga
gaaatgtctcctctggtggattccattgtgggttggatgacagagtacctaaacagtcacttgcaaaattggatccagga
acagggaggatgg
© 1998-2018