Dataset for CDS BCL-2-like of organism Xiphophorus maculatus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|M4A3H9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Xiphophorus maculatus GN=MCL-1 (length=828 residues).
atgacagctaattcgacaaacgcgttaaactatctcattttttctcaaaatggagtcgggaatggacaaacacactacga
ccagggactcggtgtgcctgaggtcgcaatgggctccactgtagaatctcttcattcgcctaaggatcccttcatgaaac
gcccgacgaatctcggagtgaatggatatgttgcgaaaagccttccgacgagcagcgacgacagcgacgaaggctctctg
ccatgcaccccggcgcagcacccagacagtgaaaaagacgcgacggccgtaggtgcgagcaaccaagtgctggataacga
cacaacggagcttattagcagttttctgagagactttacgggactttcaaagtgtcggtggggtcaaaataaagctctat
ctacgatgaaaagggtggtggaggaccttttgtcgaagcacaagtatgcatacaatggtatggtcaataggcttgctctg
gataacgagccggacgacatggagtttgttacggaaatagcagagagtctcttttcagacgggatcaccaactggggtcg
gatcgccagcctggtgacgttcggggctgcggtgtgtcagcgcctgaaggagaggggcagagagcactgcgtggagctgg
tgagccggaaaatatccacgtatctcctggcaaaccagcgggactggctagcaaaaaacaactcatgggagggctttgtg
gagttctttagagtatcggacccggagtctacagtgaggaacacgctgatggctgttgtgggggtcgctggtattggggc
caccttagcctttcttatcagcttctga
>gnl|bcl2dbcds|M4A558_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Xiphophorus maculatus GN=BCL2L1 (length=660 residues).
atggcctacagcaacagagaactggtggagttctacataagctacaaattgtctcagagaaactattcaagctctctgct
gaggtccgaggttgccgggggcaggaccaattgggaaggggacagccgggtccctagcaatggccggctggtcaacagcc
gggccgggcccccggggaagcccaggggcccaatggccggtgttgaggtcgtcaaatcagttctgaaggacgcggcggag
gagtttgagcgcctctacacccaaagctttaaacacctctccttgcagctggacatcacccccgacacggcctaccacag
cttcaagaccgtgctggacgagttgttcaagggcggggtcaactgggggcgggtggtggccatgtttaccttcgggggga
ttctgtgtgtggactgcgtccagaagaatatgagtgagctggtctcccgcattgccgaatggatgaccacttacctggat
gagcagctcagtccctggatccagagccagggaggatgggaccgctttgctaacctgtacggccaggacgccgctgcaga
gggccggaggtttcgggagaccttgaacaaatggctgctagttggtgtggctctgctgaccggagctctgctcgtcgtgt
tcgtcgctaagaaacgatga
>gnl|bcl2dbcds|M4AQF9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Xiphophorus maculatus GN=BCL2L1 (length=618 residues).
caaaaaatgtcacgaaacagagaactggtgcttttctacattaagtttaaactgtctcagaggaactatccgatccaaca
catattgcccaacgagcccccggacggcaccgctgccggggacgtggggatggacgacgagcagacgttagagacacacg
ctaatgggacttttaacgggacgagtccaggatcccctaggcggcaccaggcggcgtcggcgtcaacgatggacgcggtg
aaagtggccctgcgcgacacggcccgtgagtttgagctgcgctactcccgcgccttcaacgaccttcacagcacgctgca
catcacaccggccaccgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactggggccgca
tcgtggggctcttcgcgtttggtggcgcgctgtgcgtggagtgcgtggagaaggagatgagccacctggtagccaggatt
gtagagtggatgaccgtctacctggatgagcagattgaaccttgggtagaaagccaaggaggatggctgaagactgctgt
tatatttaaccaaggaatgagaatagaaaccagaaattggcatgagccagacaagcgt
>gnl|bcl2dbcds|M4AUW7_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Xiphophorus maculatus GN=BCL2L10 (length=651 residues).
atgcgccgaggttctccttccgccgtctggatgtgcagagagccgtcacatatcgctgggaggaaaatgtcctgtgggct
gtggaaagagaccgtggttgttgcagaggattacatccgcctgcgctgctcaagcccacacccagcccctccacctccca
gcgagccggccgccgccatgaggcgcctggcccaggacgtggaggccaagcaccaggctcgctttcactccctggcccag
ggcttcctgaagcactgcgggtcggacctctgctccaacctcagaaaggtgatggatgagatggtgggggacggacactt
taactgggggagggtggtgtccctcttcgccttcgccggcgtgctggccagacagctgcgggaacagacgggcaagaacc
cggtgccggactccgggaagcagcaggaactgcaacaagagcccgtaagctgccgggcgctggcggagaccattgctgat
tacctggagaagcacaaaaaggactggctacaggaaaataatggatgggaagggttttgtagctatgcccgcaacgccag
agaagcaagtcaggactcctccatgaagacggcgctggttgctgtcgccggggtcggcatcgctggactcaccttcctcc
tggtgcgctag
© 1998-2018