Dataset for CDS BCL2L10 of organism Xiphophorus maculatus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|M4AUW7_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Xiphophorus maculatus GN=BCL2L10 (length=651 residues).
atgcgccgaggttctccttccgccgtctggatgtgcagagagccgtcacatatcgctgggaggaaaatgtcctgtgggct
gtggaaagagaccgtggttgttgcagaggattacatccgcctgcgctgctcaagcccacacccagcccctccacctccca
gcgagccggccgccgccatgaggcgcctggcccaggacgtggaggccaagcaccaggctcgctttcactccctggcccag
ggcttcctgaagcactgcgggtcggacctctgctccaacctcagaaaggtgatggatgagatggtgggggacggacactt
taactgggggagggtggtgtccctcttcgccttcgccggcgtgctggccagacagctgcgggaacagacgggcaagaacc
cggtgccggactccgggaagcagcaggaactgcaacaagagcccgtaagctgccgggcgctggcggagaccattgctgat
tacctggagaagcacaaaaaggactggctacaggaaaataatggatgggaagggttttgtagctatgcccgcaacgccag
agaagcaagtcaggactcctccatgaagacggcgctggttgctgtcgccggggtcggcatcgctggactcaccttcctcc
tggtgcgctag
© 1998-2018