Dataset for CDS BCL-2-like of organism Xenopus tropicalis

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|F6TEC3_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Xenopus tropicalis GN=BCL2L2 (length=678 residues).
cgaaaaaaggggaataacggcgtaaaggaccgagattgggaagaacagcatgcgacgggaaatatcatcttccgggggag
ccccgataagtacctgacggagcaaggctggatggcgcaatctgaactaggatcccgggctttggtagaggattttgtgc
gatacaagttatgccagcgtagtctagttccggagcctgcaggagcagcatcctgttctttgcattcagccatgcgtgct
gcaggggatgaatttgaagagagattcagacaagcattcagtgagatctccacacagatccatgtgacccctggcacagc
atatgcacgctttgcagaagtagcaggtagcctgttccaaggtggggtgaattggggtcgtatagttgcattttttgttt
ttggtgccgcactgtgtgctgagagtgtcaacaaggagatgtcccctcttctgccacggattcaggactggatggtgaca
tatctggagacaaacctgagagactggattcagagcaatggaggctggaatggatttctaactctatatggggatggtgc
catagaagaggccaggaggcagcgtgaggggaattgggcatcactgaagactgtcttaactggagcagtagctctgggtg
ctttaatgacagtaggagccttgtttgccagcaagtga
>gnl|bcl2dbcds|F7BXJ7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Xenopus tropicalis GN=BCL-2 (length=573 residues).
atggctcatcctaggagaggaggctatgatcaccgggacatagtggtaaaatatatccattataaactgtctcaaaaggg
gtatgaatgggaagaggggcggcagcaggtctctgctgagcaccctcaagcttctgctgctattagtaattattctgatg
atggagaaatgcctgctgcttccgcagattcacgtggaccacctcaatcttcactcgcatctgctgctgcttcctcagca
gctatgcagccggtccctccagcagtgctacagaccttaagtcgagctggagatgagttctctcgcctctatcagcaaga
ttttagacagatctcagggctcctccatttaaccccatccacagttagggtgcgctttgcaacagtagtggaggagctct
ttcatgatggggtcaactggggaaggattgttgcttttttcgagtttggtggggtcatgtgcgtggaaagtgttaatcga
gaaatgtctcctctggtggattccattgtgggttggatgacagagtacctaaacagtcacttgcaaaattggatccagga
acagggaggatgg
>gnl|bcl2dbcds|F7ETY1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Xenopus tropicalis GN=MCL-1 (length=852 residues).
atgatgcgccagtcggtcattgccaagcagcgtacctctgcgggcttcctcatcccctgccagttctactgctcgggtgg
cggcggcgggaacgcctcagagaaggcagtgaatgaccgaggggcttctccgtgggacgccgatatggaggcgcataggg
ataagctggacaggccgcagctgaatggcttcgggtttaacagtggggggagccttactgcctcccaggagggagaattg
gatgaggatattgatggcggctcccagggttctagctcccccccggacagccctgtgtgcccgaaggatggattatatat
ggacacccagcagctcatcctggctttcttccggggatactgcggggaggaaaccagcggcttaaaggcctccttcctcc
tccatcatggcgcccaccccaaggccctggagaccctgcagcgggtcgggggagacattatagagaagcaccatatggcc
tttactggcatgctgcaaaggttgtctatacatagtagagaggacttgcagaaactttccgaagttcccgctttggtctt
taatgatggagttacaaactggggccggattgttaccgtcataagctttggtgcgtttgttgcaaagcatctaaagagca
tagaccttgaagactgtatcatggctttggcggagcacttcacactattcctaatgacaagcaaaaaagactggataatc
caggaaaagggatgggagggctttgtggacttttttcacatagaagactatgaaagtggactcagaactgttttgatggc
tttctcaagtgttgcggttcttggggctggcttggcgttcatgatccggtga
>gnl|bcl2dbcds|Q5XGJ4_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Xenopus tropicalis GN=BCL2L2 (length=567 residues).
atggcgcaatctgaactaggatcccgggctttggtagaggattttgtgcgatacaagttatgccagcgtagtctagttcc
ggagcctgcaggagcagcatcctgttctttgcattcagccatgcgtgctgcaggggatgaatttgaagagagattcagac
aagcattcagtgagatctccacacagatccatgtgacccctggcacagcatatgcacgctttgcagaagtagcaggtagc
ctgttccaaggtggggtgaattggggtcgtatagttgcattttttgtttttggtgccgcactgtgtgctgagagtgtcaa
caaggagatgtcccctcttctgccacggattcaggactggatggtgacatatctggagacaaacctgagagactggattc
agagcaatggaggctggaatggatttctaactctatatggggatggtgccatagaagaggccaggaggcagcgtgagggg
aattgggcatcactgaagactgtcttaactggagcagtagctctgggtgctttaatgacagtaggagccttgtttgccag
caagtga
>gnl|bcl2dbcds|Q6GLI5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Xenopus tropicalis GN=BCL2L1 (length=606 residues).
atggagggcagcagtagagatctggtggagaagtttgtttgcaagaaactgtcccagaaaggagcctgcggggagttctc
cagcaactcccagcccaagggcgtgtctaatggaagttcggagggccccggggccacacagggcattgtgggggaggaag
tccttcaggcgctgctggacgcgtcggaggagtttgagttgagataccagcgtgccttcagcgacctgaccgcccagctg
cacctcacccaggacactgcccagcaaagcttccagcaggtggtgggggagttgttcagggacggcaccaactggggcag
aatcgtggccttcttctcctttgggcgggccctgtgcgtggagagtgccaacaaggagatgactgagctgctccccagga
tcgtgcaatggatggtgcagtacctggagcatacgctgcagccctggatgctggagaacggaggctgggaagcttttgtc
ggtctgtacggaaagggagctgccgcccagagcagggaagggccggagcggtttggccggtggctaatggccatagtgac
tgtgactgctgcaaccttattggtctcctacctgaggcgtcgatag
© 1998-2018