Dataset for CDS BCL2L2 of organism Xenopus tropicalis

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|F6TEC3_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Xenopus tropicalis GN=BCL2L2 (length=678 residues).
cgaaaaaaggggaataacggcgtaaaggaccgagattgggaagaacagcatgcgacgggaaatatcatcttccgggggag
ccccgataagtacctgacggagcaaggctggatggcgcaatctgaactaggatcccgggctttggtagaggattttgtgc
gatacaagttatgccagcgtagtctagttccggagcctgcaggagcagcatcctgttctttgcattcagccatgcgtgct
gcaggggatgaatttgaagagagattcagacaagcattcagtgagatctccacacagatccatgtgacccctggcacagc
atatgcacgctttgcagaagtagcaggtagcctgttccaaggtggggtgaattggggtcgtatagttgcattttttgttt
ttggtgccgcactgtgtgctgagagtgtcaacaaggagatgtcccctcttctgccacggattcaggactggatggtgaca
tatctggagacaaacctgagagactggattcagagcaatggaggctggaatggatttctaactctatatggggatggtgc
catagaagaggccaggaggcagcgtgaggggaattgggcatcactgaagactgtcttaactggagcagtagctctgggtg
ctttaatgacagtaggagccttgtttgccagcaagtga
>gnl|bcl2dbcds|Q5XGJ4_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Xenopus tropicalis GN=BCL2L2 (length=567 residues).
atggcgcaatctgaactaggatcccgggctttggtagaggattttgtgcgatacaagttatgccagcgtagtctagttcc
ggagcctgcaggagcagcatcctgttctttgcattcagccatgcgtgctgcaggggatgaatttgaagagagattcagac
aagcattcagtgagatctccacacagatccatgtgacccctggcacagcatatgcacgctttgcagaagtagcaggtagc
ctgttccaaggtggggtgaattggggtcgtatagttgcattttttgtttttggtgccgcactgtgtgctgagagtgtcaa
caaggagatgtcccctcttctgccacggattcaggactggatggtgacatatctggagacaaacctgagagactggattc
agagcaatggaggctggaatggatttctaactctatatggggatggtgccatagaagaggccaggaggcagcgtgagggg
aattgggcatcactgaagactgtcttaactggagcagtagctctgggtgctttaatgacagtaggagccttgtttgccag
caagtga
© 1998-2018