Dataset for CDS BCL-2-like of organism Xenopus laevis

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|B6V6J0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Xenopus laevis GN=MCL-1 (length=828 residues).
atgatgcaccagtcagtaattgccaagcagcgcccctcgactagtttcctcattccctgccagttttactgctcgggcgg
cggctcctcagagaagacattgagcgcgcgtggggcttctccgtgggaccccgatatggacacgcacaggccgcagctga
atggcttgggctttaacaacggggggtcgctgccttgttcccaggaggatgaattagatgaggatatggataacggatcc
cagggttccacgtctcccccggacagccccgtgtgccctaaggatggattatatatggacacccagcagctcattctcgc
tttctaccgcgtgtacagcggcgaggagagcggcgaattagaggcttcctgtctcctccaacatggcgtccaccacaaag
ccctggaaaccctgctgagggtcgggggagagattatagagaagcaccacatggccttcacgggcatgctacaaaggttg
tctatacatagcagagaagacttgcagaaactttctgaggttcccgctttggtctttaatgacggagttacaaattgggg
ccgcattgttacggtcataagctttggcgcgtttgttgcaaagcatctaaagagcttaaaccttgaagactgcatcggag
ttttggcagagcacttcacgcagttcctaatgatgagcaaaaaagactggataatacaggaaaagggatgggatggcttt
gtggacttttttcacatagaagattatgaaagtggactgaaaactgttttgatggctttctcaagtgttgctgttcttgg
ggccggtttggcgtacatgatccgatga
>gnl|bcl2dbcds|B9ZYL7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Xenopus laevis GN=BCL-2 (length=885 residues).
atggctcatcctagaagaggaggctatgatcaccgggacatagtggtaaaatatatccattataaactatctcagaaggg
gtatgcatgggaagagggaaggcagcaggtctctgctgagcaccctcaagcttctgctgctattagtaattattctgatg
atggagaaatgcctgctgcttccgcagattcacgtggaccacctcagtcttcactcgcatctgctgcttcctcagatgag
gaaaccccaagtaatactccaataacctttgtgggcaatgcacctgctgttcccaggaggtctgcatctgctgtttcacc
cttagctgaattgaatgtcgaaccaagagatcttaatgttaatccagatgccagtcgtgctgcagatggtgataataatg
atgctgatggtggtgatgaagctgttatgcagccagtcccttcggcagtgctacagaccttgagtcgagctggagatgag
ttctctcgcctatatcagcaagatttcagacagatctcagggctcctccatttaaccccatccacagttagggtgcgctt
tgcaacagtggtggaggagctctttcatgatggggtaaactggggaaggattgttgcttttttcgagtttggtggggtca
tgtgcgtggagattgttaaccgcgaaatgtctcctctggtggactccattgtgggttggatgacagagtacctaaaccgt
cacttacaaaattggatccaggaacaggatgcatttgtggagctgtacaacagcaatatccagccaccgtttgaccagag
ctggttatccatcaagacaatattaagccttgctgtggttggagcctgcatcacaatagggggcatatccttggccacca
aataa
>gnl|bcl2dbcds|Q2TAP5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Xenopus laevis GN=BCL2L1 (length=615 residues).
atggagggcagcagtagagatctggtggagaagtttgttagtaagaaactttcccagaatgaagcctgcaggaagttctc
caataatccccaacccaatgccatatctaatggaacttctacttcagagcgccccggggaaggggccacgcagggcattg
tggaggaggaagtccttcaagcccttttggaagcaacggaggagtttgagttgagatatcagcgtgccttcagtgacctg
acctcacagctgcacatcacccaggacacggcccagcagagcttccagcaagttatgggagagttgttcagggatgggac
aaactgggggagaattgtggctttcttctcatttgggcgggccctatgtgtggagagtgcaaacaaggagatgactgatc
tgctacccagaattgtccagtggatggtgaattatctagagcacacactgcagccctggatgcaggagaatggaggctgg
gaagcttttgtcggcctgtatggaaagaatgccgcagcccagagcagagaaagccaggaacgatttggcaggttgctgac
tatagtgattctgactggtgttttcgcattggtctgctacatgaggcgccgatag
>gnl|bcl2dbcds|Q91828_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Xenopus laevis GN=BCL2L1 (length=615 residues).
atggagggcagcagtagagatctggtggagaagtttgttagtaagaaactttcccagaatgaagcctgcaggaagttctc
caataatcccaacccaatgccatatctaatggaaccttctacttcagagcgccccggggaaggggccacgcagggcattg
tggaggaggaagtccttcaagcccttttggaagcaacggaggagtttgagttgagatatcagcgtgccttcagtgacctg
acctcacagctgcacatcacccaggacacggcccagcagagcttccagcaagttatgggagagttgttcagggatgggac
aaactgggggagaattgtggctttcttctcatttgggcgggccctatgtgtggagagtgcaaacaaggagatgactgatc
tgctacccagaattgtccagtggatggtgaattatctagagcacacactgcagccctggatgcaggagaatggaggctgg
gaagcttttgtcggcctgtatggaaagaatgccgcagcccagagcagagaaagccaggaacgatttggcaggttgctgac
tatagtgatgctgactggtgttttcgcattggtctgctacatgaggcgccgatag
© 1998-2018