Dataset for CDS BCL2L1 of organism Xenopus laevis

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|Q2TAP5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Xenopus laevis GN=BCL2L1 (length=615 residues).
atggagggcagcagtagagatctggtggagaagtttgttagtaagaaactttcccagaatgaagcctgcaggaagttctc
caataatccccaacccaatgccatatctaatggaacttctacttcagagcgccccggggaaggggccacgcagggcattg
tggaggaggaagtccttcaagcccttttggaagcaacggaggagtttgagttgagatatcagcgtgccttcagtgacctg
acctcacagctgcacatcacccaggacacggcccagcagagcttccagcaagttatgggagagttgttcagggatgggac
aaactgggggagaattgtggctttcttctcatttgggcgggccctatgtgtggagagtgcaaacaaggagatgactgatc
tgctacccagaattgtccagtggatggtgaattatctagagcacacactgcagccctggatgcaggagaatggaggctgg
gaagcttttgtcggcctgtatggaaagaatgccgcagcccagagcagagaaagccaggaacgatttggcaggttgctgac
tatagtgattctgactggtgttttcgcattggtctgctacatgaggcgccgatag
>gnl|bcl2dbcds|Q91828_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Xenopus laevis GN=BCL2L1 (length=615 residues).
atggagggcagcagtagagatctggtggagaagtttgttagtaagaaactttcccagaatgaagcctgcaggaagttctc
caataatcccaacccaatgccatatctaatggaaccttctacttcagagcgccccggggaaggggccacgcagggcattg
tggaggaggaagtccttcaagcccttttggaagcaacggaggagtttgagttgagatatcagcgtgccttcagtgacctg
acctcacagctgcacatcacccaggacacggcccagcagagcttccagcaagttatgggagagttgttcagggatgggac
aaactgggggagaattgtggctttcttctcatttgggcgggccctatgtgtggagagtgcaaacaaggagatgactgatc
tgctacccagaattgtccagtggatggtgaattatctagagcacacactgcagccctggatgcaggagaatggaggctgg
gaagcttttgtcggcctgtatggaaagaatgccgcagcccagagcagagaaagccaggaacgatttggcaggttgctgac
tatagtgatgctgactggtgttttcgcattggtctgctacatgaggcgccgatag
© 1998-2018