Dataset for CDS BCL-2 of organism Xenopus laevis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|B9ZYL7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Xenopus laevis GN=BCL-2 (length=885 residues).
atggctcatcctagaagaggaggctatgatcaccgggacatagtggtaaaatatatccattataaactatctcagaaggg
gtatgcatgggaagagggaaggcagcaggtctctgctgagcaccctcaagcttctgctgctattagtaattattctgatg
atggagaaatgcctgctgcttccgcagattcacgtggaccacctcagtcttcactcgcatctgctgcttcctcagatgag
gaaaccccaagtaatactccaataacctttgtgggcaatgcacctgctgttcccaggaggtctgcatctgctgtttcacc
cttagctgaattgaatgtcgaaccaagagatcttaatgttaatccagatgccagtcgtgctgcagatggtgataataatg
atgctgatggtggtgatgaagctgttatgcagccagtcccttcggcagtgctacagaccttgagtcgagctggagatgag
ttctctcgcctatatcagcaagatttcagacagatctcagggctcctccatttaaccccatccacagttagggtgcgctt
tgcaacagtggtggaggagctctttcatgatggggtaaactggggaaggattgttgcttttttcgagtttggtggggtca
tgtgcgtggagattgttaaccgcgaaatgtctcctctggtggactccattgtgggttggatgacagagtacctaaaccgt
cacttacaaaattggatccaggaacaggatgcatttgtggagctgtacaacagcaatatccagccaccgtttgaccagag
ctggttatccatcaagacaatattaagccttgctgtggttggagcctgcatcacaatagggggcatatccttggccacca
aataa
© 1998-2018