Dataset for CDS BCL-2-like of organism Ursus maritimus

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|A0A384D3U1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ursus maritimus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaaggaactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcgctgagggaggccggggatgagttcgaactgaggtaccggcgggcattcagcga
cctgacatcccagcttcacatcaccccagggacagcgtatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcattgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggacactttcgtggaactctacgggaacaatgcagcggctgaaagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A384DPS8_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Ursus maritimus GN=BCL2L2 (length=996 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaaaggtta
tgtgtgtggagctggccctggggagggcccagcagctgacccactgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccagcaacgcttcacc
caggtctctgacgaactcttccaagggggccccaactggggccgcctggtggccttctttgtctttggagccgcactgtg
tgctgagagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
tggctgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaaacagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtctattgaagagaagatggaggctgatgcccgttccatctatgttggcaacgtggactatggtgcaacagcagaag
agctggaagcacactttcatggctgtggttcagtcaatcgtgttaccatactctgtgacaaatttagtggccatcctaaa
gggtttgcatatatagagttctcagataaagagtcagtgaggacttccttggccttagatgagtccctgtttagaggaag
acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccacgagcccgatacc
gtgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtttctgtag
>gnl|bcl2dbcds|A0A384DPS8_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Ursus maritimus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaaaggtta
tgtgtgtggagctggccctggggagggcccagcagctgacccactgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccagcaacgcttcacc
caggtctctgacgaactcttccaagggggccccaactggggccgcctggtggccttctttgtctttggagccgcactgtg
tgctgagagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacaggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A384DPS8_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Ursus maritimus GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaaaggtta
tgtgtgtggagctggccctggggagggcccagcagctgacccactgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccagcaacgcttcacc
caggtctctgacgaactcttccaagggggccccaactggggccgcctggtggccttctttgtctttggagccgcactgtg
tgctgagagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
tggctgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaaacagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtctattgaagagaagatggaggctgatgcccgttccatctatgttggcaacgtggactatggtgcaacagcagaag
agctggaagcacactttcatggctgtggttcagtcaatcgtgttaccatactctgtgacaaatttagtggccatcctaaa
gggtttgcatatatagagttctcagataaagagtcagtgaggacttccttggccttagatgagtccctgtttagaggaag
acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccacgagcccgatacc
gtgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A452T603_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ursus maritimus GN=BCL-2 (length=534 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgaccccgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgact
tcgcggagatgtccagccagctgcacctgacacccttcaccgcaaggggacgctttgccacggtggtggaggagctcttc
agggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccggga
gatgtcgcccctggtggacaacattgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggaca
acggaggctgggtaggtgcacgtccgcttgaatgtgcgtctgggctgcacgtttcaaatctgaggctgagaatccgtggt
tggagtgtgggtgggctcttgggccaagggcaaactgatgagccagggaaataa
>gnl|bcl2dbcds|A0A452U2H8_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Ursus maritimus GN=BCL2A1 (length=651 residues).
atgcacacagaaattccaccggcctccgcgcgtcccatgagtcaccgccccagccccgccggcgctcgcctcatttggcc
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnggggcgggtggaagatgacagactgcgagttcgggtacaccctgacgctgg
cccaggactacgtgaagcacgtcctgcagatcccgcagccgggctcagccccgagcagggcgtcccaggtgctgcgggac
gtggcctcctccgtgcagggggaggtggaaaagaacttgaaaccatgcctggacagtttcgatgtggtgtccgtcgactc
cgccagaaccatattcaatcaggtcatggaaaaggaatttgaagacggcatcattaactggggaagaattgtgaccatat
ttgcgttcgaagggattctcaccaagaaactcctccaggagcgaatctccccggatgtggacgcttctaggatttcttac
ttcgtggcggagttcatcacgacaaacatgagagagtggataaggcagaacggaggctggtccctcctcccgccctctgc
cagtgtgaagggctgcaagcggagggcccccggcaggtctgagaggagagctgctgccaccttttcagctggctccagcg
ttcgtgagtag
>gnl|bcl2dbcds|A0A452U2H8_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Ursus maritimus GN=BCL2A1 (length=648 residues).
atgcacacagaaattccaccggcctccgcgcgtcccatgagtcaccgccccagccccgccggcgctcgcctcatttggcc
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnggggcgggtggaagatgacagactgcgagttcgggtacaccctgacgctgg
cccaggactacgtgaagcacgtcctgcagatcccgcagccgggctcagccccgagcagggcgtcccaggtgctgcgggac
gtggcctcctccgtgcagggggaggtggaaaagaacttgaaaccatgcctggacagtttcgatgtggtgtccgtcgactc
cgccagaaccatattcaatcaggtcatggaaaaggaatttgaagacggcatcattaactggggaagaattgtgaccatat
ttgcgttcgaagggattctcaccaagaaactcctccaggagcgaatctccccggatgtggacgcttctaggatttcttac
ttcgtggcggagttcatcacgacaaacatgagagagtggataaggcagaacggaggctgggaagatggctttgtaaagaa
gttcgaacccaagtctggctggctgacttttctggaagttatggggaagatctgtgaaatgttctctctcctgaagcaat
actactga
© 1998-2019