Dataset for CDS BCL2L2 of organism Ursus maritimus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A384DPS8_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Ursus maritimus GN=BCL2L2 (length=996 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaaaggtta
tgtgtgtggagctggccctggggagggcccagcagctgacccactgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccagcaacgcttcacc
caggtctctgacgaactcttccaagggggccccaactggggccgcctggtggccttctttgtctttggagccgcactgtg
tgctgagagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
tggctgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaaacagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtctattgaagagaagatggaggctgatgcccgttccatctatgttggcaacgtggactatggtgcaacagcagaag
agctggaagcacactttcatggctgtggttcagtcaatcgtgttaccatactctgtgacaaatttagtggccatcctaaa
gggtttgcatatatagagttctcagataaagagtcagtgaggacttccttggccttagatgagtccctgtttagaggaag
acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccacgagcccgatacc
gtgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtttctgtag
>gnl|bcl2dbcds|A0A384DPS8_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Ursus maritimus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaaaggtta
tgtgtgtggagctggccctggggagggcccagcagctgacccactgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccagcaacgcttcacc
caggtctctgacgaactcttccaagggggccccaactggggccgcctggtggccttctttgtctttggagccgcactgtg
tgctgagagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacaggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A384DPS8_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Ursus maritimus GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaaaggtta
tgtgtgtggagctggccctggggagggcccagcagctgacccactgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccagcaacgcttcacc
caggtctctgacgaactcttccaagggggccccaactggggccgcctggtggccttctttgtctttggagccgcactgtg
tgctgagagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
tggctgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaaacagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtctattgaagagaagatggaggctgatgcccgttccatctatgttggcaacgtggactatggtgcaacagcagaag
agctggaagcacactttcatggctgtggttcagtcaatcgtgttaccatactctgtgacaaatttagtggccatcctaaa
gggtttgcatatatagagttctcagataaagagtcagtgaggacttccttggccttagatgagtccctgtttagaggaag
acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccacgagcccgatacc
gtgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
© 1998-2019