Dataset for CDS BCL2A1 of organism Ursus maritimus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A452U2H8_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Ursus maritimus GN=BCL2A1 (length=651 residues).
atgcacacagaaattccaccggcctccgcgcgtcccatgagtcaccgccccagccccgccggcgctcgcctcatttggcc
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnggggcgggtggaagatgacagactgcgagttcgggtacaccctgacgctgg
cccaggactacgtgaagcacgtcctgcagatcccgcagccgggctcagccccgagcagggcgtcccaggtgctgcgggac
gtggcctcctccgtgcagggggaggtggaaaagaacttgaaaccatgcctggacagtttcgatgtggtgtccgtcgactc
cgccagaaccatattcaatcaggtcatggaaaaggaatttgaagacggcatcattaactggggaagaattgtgaccatat
ttgcgttcgaagggattctcaccaagaaactcctccaggagcgaatctccccggatgtggacgcttctaggatttcttac
ttcgtggcggagttcatcacgacaaacatgagagagtggataaggcagaacggaggctggtccctcctcccgccctctgc
cagtgtgaagggctgcaagcggagggcccccggcaggtctgagaggagagctgctgccaccttttcagctggctccagcg
ttcgtgagtag
>gnl|bcl2dbcds|A0A452U2H8_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Ursus maritimus GN=BCL2A1 (length=648 residues).
atgcacacagaaattccaccggcctccgcgcgtcccatgagtcaccgccccagccccgccggcgctcgcctcatttggcc
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnggggcgggtggaagatgacagactgcgagttcgggtacaccctgacgctgg
cccaggactacgtgaagcacgtcctgcagatcccgcagccgggctcagccccgagcagggcgtcccaggtgctgcgggac
gtggcctcctccgtgcagggggaggtggaaaagaacttgaaaccatgcctggacagtttcgatgtggtgtccgtcgactc
cgccagaaccatattcaatcaggtcatggaaaaggaatttgaagacggcatcattaactggggaagaattgtgaccatat
ttgcgttcgaagggattctcaccaagaaactcctccaggagcgaatctccccggatgtggacgcttctaggatttcttac
ttcgtggcggagttcatcacgacaaacatgagagagtggataaggcagaacggaggctgggaagatggctttgtaaagaa
gttcgaacccaagtctggctggctgacttttctggaagttatggggaagatctgtgaaatgttctctctcctgaagcaat
actactga
© 1998-2019