Dataset for CDS BCL-2 of organism Ursus maritimus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A452T603_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ursus maritimus GN=BCL-2 (length=534 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgaccccgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgact
tcgcggagatgtccagccagctgcacctgacacccttcaccgcaaggggacgctttgccacggtggtggaggagctcttc
agggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccggga
gatgtcgcccctggtggacaacattgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggaca
acggaggctgggtaggtgcacgtccgcttgaatgtgcgtctgggctgcacgtttcaaatctgaggctgagaatccgtggt
tggagtgtgggtgggctcttgggccaagggcaaactgatgagccagggaaataa
© 1998-2019