Dataset for CDS BCL-2-like of organism Ursus americanus

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|A0A452QJG0_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Ursus americanus GN=BCL2L10 (length=594 residues).
atggcggacgcgctgagggagcgcacggcgcggctgctgaccgactacctggagtactgcgcccgggagcccggcacccc
tgcgcgggcgccgtccacgcccgaggccgcggtgctgcgctcggtggccgcccaggtccagcagcgtcacgagcacttct
tgtccgattaccgcggctacggcggcaaccgcgtggagctggtggctcaggtggagcgggagatactcgcccacccccag
cccctaagctggggccgtgtggtggcgctcctcaccttcgcgggcacactgctggagagatcgccgtcggggacctactc
gaacctggggccggaccaggaactggagctgggggagcgggaggccggcgtccgccaggactgccggcacctggtggact
tcctctgcaatcggctcacgggacagcatcgcgcctggctggaggcgcacgacggctgggtgaatggcttttgtctcttc
ttcacacccatgctggccgtccgtcttggaaaagactgctggcccaggctcttctgtcctgcttcacaggcagtgatctt
aatctacttctggaaaagattatgtgagttctga
>gnl|bcl2dbcds|A0A452R145_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ursus americanus GN=BCL-2 (length=492 residues).
atgccggagacgcgggcgccgcgcccccgggggccgcccccgcgccgggcatcttctcctcccagcctgggctcaccccc
gcgcccgccaggacctcgccgcttaccgcccccggccgcccccgccgccgccgccgccgccgcgggccctgcgctcagcc
ccgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgacttcgcggag
atgtccagccagctgcacctgacacccttcaccgcaaggggacgctttgccacggtggtggaggagctcttcagggatgg
ggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgc
ccctggtggacaacattgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggacaacggaggc
tgggcacactaa
>gnl|bcl2dbcds|A0A452R145_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ursus americanus GN=BCL-2 (length=618 residues).
atgccggagacgcgggcgccgcgcccccgggggccgcccccgcgccgggcatcttctcctcccagcctgggctcaccccc
gcgcccgccaggacctcgccgcttaccgcccccggccgcccccgccgccgccgccgccgccgcgggccctgcgctcagcc
ccgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgacttcgcggag
atgtccagccagctgcacctgacacccttcaccgcaaggggacgctttgccacggtggtggaggagctcttcagggatgg
ggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgc
ccctggtggacaacattgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggacaacggaggc
tgggatgcctttgtggagttgtacggccccagcatgcagcctctgtttgacttctcctggctgtctctgaaggccctgct
cagtctggccctggtgggagcttgcatcaccctgggtgcctacctgggccacaagtga
>gnl|bcl2dbcds|A0A452RHX5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ursus americanus GN=MCL-1 (length=1053 residues).
atgtttggcctgaagagaaacgcagtaatcggactcaacctctactgtgggggggccgggttgggggccggcagcggcgg
cgccgcctcatcgggagggcggcttttggcttcggggaaggaggccacggcccggcgggaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgctagtcccccggccactctcgcgccggacgcccggagggtcgcgcggccctcg
cccattggcgccgagggtcccgacgtcacggcgacccccccgaggctactgttcctcgagcccacccgccgcgcgtcgcc
gcctgaagagatggaaggcccagccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggaacctt
tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagcggtggcccttgtacggacggctcactg
ccctcgacgccacccccagcagaggaggaggaagacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcaacaggcgccaaggacgcgaaaccgctgggcgggtctggggcggccagccggaaggcgttagagaccctcc
gacgggtcggggacggggtacagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A452SDS4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ursus americanus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaaggaactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcgctgagggaggccggggatgagttcgaactgaggtaccggcgggcattcagcga
cctgacatcccagcttcacatcaccccagggacagcgtatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcattgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggacactttcgtggaactctacgggaacaatgcagcggctgaaagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A452SHI1_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Ursus americanus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaaaggtta
tgtgtgtggagctggccctggggagggcccagcagctgacccactgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccagcaacgcttcacc
caggtctctgacgaactcttccaagggggccccaactggggccgcctggtggccttctttgtctttggagccgcactgtg
tgctgagagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacaggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A452SIR9_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Ursus americanus GN=BCL2A1 (length=525 residues).
atgacagactgtgagttcgggtacaccctgacgctggcccaggactacgtgaagcacgtcctgcagatcccgcagccggg
ctcagccccgagcagggcgtcccaggtgctgcgggacgtggcctcctccgtgcagggggaggtggaaaagaacttgaaac
catgcctggacagtttcgatgtggtgtccgtcgactccgccagaaccatattcaatcaggtcatggaaaaggaatttgaa
gacggcatcattaactggggaagaattgtgaccatatttgcgttcgaagggattctcaccaagaaactcctccaggagcg
aatctccccggatgtggacgcttctaggatttcttacttcgtggcagagttcatcacgacaaacatgagagagtggataa
ggcagaacggaggctgggaagatggctttgtaaagaagttcgaacccaagtctggctggctgacttttctggaagttacg
gggaagatctgtgaaatgttctctctcctgaagcaatactactga
© 1998-2019