Dataset for CDS BCL-2 of organism Ursus americanus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A452R145_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ursus americanus GN=BCL-2 (length=492 residues).
atgccggagacgcgggcgccgcgcccccgggggccgcccccgcgccgggcatcttctcctcccagcctgggctcaccccc
gcgcccgccaggacctcgccgcttaccgcccccggccgcccccgccgccgccgccgccgccgcgggccctgcgctcagcc
ccgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgacttcgcggag
atgtccagccagctgcacctgacacccttcaccgcaaggggacgctttgccacggtggtggaggagctcttcagggatgg
ggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgc
ccctggtggacaacattgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggacaacggaggc
tgggcacactaa
>gnl|bcl2dbcds|A0A452R145_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ursus americanus GN=BCL-2 (length=618 residues).
atgccggagacgcgggcgccgcgcccccgggggccgcccccgcgccgggcatcttctcctcccagcctgggctcaccccc
gcgcccgccaggacctcgccgcttaccgcccccggccgcccccgccgccgccgccgccgccgcgggccctgcgctcagcc
ccgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgacttcgcggag
atgtccagccagctgcacctgacacccttcaccgcaaggggacgctttgccacggtggtggaggagctcttcagggatgg
ggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgc
ccctggtggacaacattgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggacaacggaggc
tgggatgcctttgtggagttgtacggccccagcatgcagcctctgtttgacttctcctggctgtctctgaaggccctgct
cagtctggccctggtgggagcttgcatcaccctgggtgcctacctgggccacaagtga
© 1998-2019