Dataset for CDS Unclassified of organism Trichoplax adhaerens

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A1B1IJN9_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Trichoplax adhaerens (length=636 residues).
atgacatcttccttcgatgaggcatcttctcagaaaataaaaactttaaaacctacattgactaacttcaaaggtactaa
tggtttcttggatgacgaacagttcttagtttataagaatataatcaaggattatatccagtctcggttacttaatgaag
gtcttttagatggaccgtatcgatgtgatataaaagatgttaaaaccaagaaagtatccgaacgcttgaaagaagttgga
aatgaattggagggaaaatttaaggattctttcagtaatatgtgcgaaagattaactattacggatacaactgcttaccc
aacgtttgtgggtgtcgttaatgagttattttctacgggtatcaactggggtaggatagtcgcatttattgttttttcaa
gtaggctggcgatccactttaaacgaaatgggatgcctgaatacgtgaagagcgtttatggatgggttgcaagatatatg
catacgaaattatctacctggatcgaagcgaacagatcttgggatggctttctggatcatttcgacaagaaaaatgagaa
tgaaaagtctagtatttttactgcaactatggctgttgctattggtacttgtgcatactttctgtttaatagataa
>gnl|bcl2dbcds|B3RSA4_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Trichoplax adhaerens (length=648 residues).
atgtctcctgaacgcgaaaaaatggtagaaactaacatagcaaactcagaaagtacggaaaattacgctaacggtacgtc
ctatttgcaacccgtaaatgacgaagaaatgtgtcgagaatcgagacagttagcgtatgattttgtctatgaagtcgttg
gtgagaagaaccctgtatcttatattcgtaaaagatcttctagtcgctgtatcaagaaattaaatcgcatgacaaaggtc
atgttagagcgtcacgatatcccatttaaaagtgcttgtacgaagatgaaactaagtaaagatgctccagtaagaagaat
gctgcaatcgattgctgctgaaatgttccgtaatggctgcaactggggacgtataactgcattatttgccttatgtcgaa
aacttgcaatcaatagtaaagagcttggatattacgacatcatatacaaaatagcaggatgtttggctgatatattaact
ggacaactacatagttggatcgctgccaagggaggctgggatgagtacgtgagctactttagagatacagaagatgtaca
agaagatgcaaaaaaatttcttatgtatactactttagccctcacggcttcttttgcagtggcgcttgcagtgtgggaaa
gatggtga
© 1998-2018