Dataset for CDS Unclassified of organism Trichinella spiralis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|E5S8V8_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Trichinella spiralis (length=651 residues).
atggtccttcatgattttgtcgatggtgaatgggtaggtgaaagatcaaattgttttgatatagcaagagacgctgtaga
atcagaagcatgcgtcattgcatgtgattatatcaatcatcgattgttaaaatcgaattatgtttggaccgattgtccag
acctgccgaagccaaattgtatatcgttatgtatgcggacgatgggtgaagaattggagcagcgctatgaacgcagcttc
aaaagcatgagcgaaacgcttcagatttcgccaactaccgcttatccgacatttctggcaatatgcgatgaattgttcaa
cgacggcatacgctggggtcgcattgttgctttgtacgcttttggcggaagtctttctcttcagtgcgtccgtaacaata
tgccagaattagtcagtagcatcgcagattggctggcaatgtatactgagacgcatttgtcgcagtggatcattgaaaat
ggcggaaggctttgtgaagttctatcacgaaagctctgtaaaacaacagacgtcatacagagaggtgatcgcaagcgttg
gcgttgtatgcgctgcgattggagtgatggccatcggtataatgatggcgaaacattgaatgtgaagacaaagtatacaa
aagtagattga
© 1998-2018