Dataset for CDS Unclassified of organism Tetraodon nigroviridis

[Download (right click)]

4 sequence(s)

>gnl|bcl2dbcds|H3C1U2_uncBCL2L10-01 Putative BCL2-like 10 gene OS=[Eukaryota] Tetraodon nigroviridis (length=546 residues).
aaaatgtcgtgcgggctgtggaaagagaccctggctctggcggaggactacctgtctgtgtgctgcgccagccagatgag
gagcctggcccaggacctggagcagcagcaccaggctcgcttccactcgctggcccacagcttcctgaggcagtgcgggc
tggacccctgctccggcctcaggacggtgatggaggagctggtgggagacggacacttgaactggggaagggttgtttcc
cttttcgcctttactggcgtgctggccagactgatgcaggagcagaagagcaccaagccggggccggaccccgggctgga
gcaggacctgggacaggcgcctggagcctgcagggcactcgccgagaccatagcagactacctgggggaggagaggaagg
actggctgctggagaatggcggatgggagggcttctccaagttctccctctccgcccgggaggtgagtcacgactcatcc
atgaagacggcgctgtttgccgccgccggggtcggtctggccgggctcaccttcctcctggtgcgc
>gnl|bcl2dbcds|H3C3G9_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Tetraodon nigroviridis (length=573 residues).
atggcgagagagtataatcgcgacattgtggagaaatatatcttccataaactgtccaagcgcggcttcgtgtggagatt
cgaggaggtccaggaccaaaacgcggcgaataacggctcggtagttgcccctgcaccgactttggttcgccggtgtcatg
aggccggtaccgggcccgaccgcgggagcatcccccacctctgcaaacgcaccccccagtccgagcagcacgccgccatc
cacagagtcctgcgggaggctggggatgaacttgagagattgtaccagccggacttcacggagatgtcgcgccagctgta
tctcacctccaccacggcgcagaggaggttcgcggaggtgatagacgaactgttccgggacggggtgaactggggccgga
ttatcgctttcttcgagttcggggccgcggtgtgcgcggagtgcgcggccaaggaggagatgagcccgcaggtggacaac
atcgcggagtggatgacggaatatttaagtgggtccctgaacagctggatacaagataacgggggatggagaaggttcaa
aaaggtgactgga
>gnl|bcl2dbcds|Q4SCG3_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Tetraodon nigroviridis (length=624 residues).
atgtctcacactaacagagagctggtggagttctatctgaactacaaactgtctcacagcaacttcctgacgtctctgcg
ggcatcagcggacgcgtggcagagccccaggattagccgcagagaccgcagcggagcctctccgtcctcggacgctggtc
gccgggctgtgaaggcagttcttcggaaggcgacggatgattttgagaagaagctcactcgagcatgtggtgatctctcc
tcgtacttgccctccaagatcagccaccaaaactttaacaacacaatggaccagattttcgaaggcaacgtgcactgggg
agtcgtcattggtctgttcgtggtaggcggcgccatgtgtgtgcagtgtgttaggaacaaccacgaggaactggtctgcc
acattgcagactggatgacggcctacttggatgagcatcttgagccctggatccagagacaaggaggctgggaggacttt
acccggagatatgaaacagttgatgaacggagccaatttgaaagaggagcgaagctttgctttctgactctggtgctgct
ggttggggggtttgtcatttttaggaaatataacgtgttccatcgcttactgcgttttctgtag
>gnl|bcl2dbcds|Q4SCG3_uncBCL2L1-02 Putative BCL2-like 1 gene OS=[Eukaryota] Tetraodon nigroviridis (length=441 residues).
cttcggaaggtgacggatgattttgagaagaagctcactcgagcatgtggcgatctctcctcgtacttgccctccaagat
cagccaccaaaactttaacaacacaatggaccagattttcgaaggcaacgtgcactggggagtcgtcattggtctgttcg
tggtaggcggcgccatgtgtgtgcagtgtgttaggaacaaccacgaggaactggtctgccacattgcagactggatgacg
gcctacttggatgagcatcttgagccctggatccagagacaaggaggctgggaggactttacccggagatatgaaacagt
tgatgaacggagccaatttgaaagaggagcgaagctttgctttctgactctgctgctggttggggggtttgtcattttta
ggaaatataacgtgttccatcgcttactgcgttttctgtag
© 1998-2018