Dataset for CDS MCL-1 of organism Tetraodon nigroviridis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|Q4SW32_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Tetraodon nigroviridis GN=MCL-1 (length=816 residues).
atgagcgttatcgcgaaccgcaccgcgatagacaccatgaatgttatgtttcaaaatggagtcggggacgcggatctttc
ttcctcgcagatcccgatgggctctcccagggacgctttcaacgggaacgtcggcgacagcccgaagcggcccagcaagc
tgacggtggtcaaacccaaggtctgcctgtcgaagaccattcaggaggacagcgaggacggctcgctgccgtgtacgccg
gagtcgcactcgggcgacgtgctggacgtgtccgggcgtccggcgggggacgaggcggctctcgacagcgacacgaggca
gctggtgagccgtttaatggcggacgttaccggcatcagcagagcccagtggagggagagcagagcgctggcgacgacga
agcgagtggtgggagacctgatggagaagcaccgatacacgtacagaggtatgatcaacaaattgttcatggaggaccga
gtaggcgacgtgagctttgtcggcgccgtggctaagagcacgttcgaggacgggaacaccaactggggtcgcgtggccag
cctgctggccttcgcagccgtggtggcccagtacttgaacgaccacggtcagagggactgcgtggagcaggtggcccagg
aaatctccacctacctgttgacggaccagcgcgactggctgatcaaaaacaacgcctgggacggatttgtggagtttttc
caagtgccggacccggagtcgacggtccggaccgtgctgatggccgtggcaggagtggctgggatcggcgccaagctggc
gctgctgatcaggtga
© 1998-2018