Dataset for CDS Unclassified of organism Takifugu rubripes

[Download (right click)]

4 sequence(s)

>gnl|bcl2dbcds|H2RZ55_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Takifugu rubripes (length=525 residues).
atgtctaatagagagctggtagagaactatttaatctacaaactctctcagaaatacccaggcactgtgtctccacccgc
aggtactggcagagaggctttgaatgcagctcttcggagcatggcaaataagtacgagcgggactttatggagcaagcgg
gtgacctctccccatacgtcgccgtgactaggaacaaggcaggttttaacaaggtgatggacgacatgttcagagataaa
atcaactggggaacagttgtaggtctttttgtcgtgggcggcgccacttatgtgcaatctttcgagggcggcgcaagtga
accggtttgccacgttgcagactggatgacagattacctggaccaacggattaatccatggatcgagagtcaaggaggat
gggtgaacaggcgtaaatggatactgggcggactggtggtactggctggtgttttgatcattgttacaaaaaattatggt
acattgcgtaaggcattttcaaattttatgtcttattggtcatag
>gnl|bcl2dbcds|H2SIR7_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Takifugu rubripes (length=642 residues).
acatcattgaagtcagtgtattttttaaattgcaaaacccaaaggaatttagagctggtggagaactatttaatctacaa
actctctcagaagaactactcaggcactctgctcagaccaaagggtgcttcaagcggtttgctggtcgatagagagagca
gtggagcgtctccatccgcaggtactggcagagaggctgtgatcgcagctcttcggagcatggcaaataagttcgagcag
gactttattcagctagcgggtgacctctcctcatacgtcgccatgactcggaaccaggcatgctttaacaaggtgatgga
tgacatgttcaggggtgaaatcaactggggaacagttgtgggtctttttgtcgtgggcggcgccatttgtgtgcaatctg
tcgagggtgacgcaagtgaaccggtttgccacattgcagactggatggcggcttacctggacaaacggattaacccatgg
atcgagagtcaaggaggatggaagcctgcacaaagtcaggaagaaaggcgtaaatggatactgggcggactggtggtgct
ggctggtgttttgatcattgttacaaaaaattatggtacattgcgtaaggcattttctcacttcatgtcttattggtcgt
ag
>gnl|bcl2dbcds|H2SKE0_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Takifugu rubripes (length=678 residues).
atggagagggagtgcaatcgcgacattgtggaaaactatatctgccataaactgtccaagcgcggcttcgcgtggagctt
tgaggatgtccaggacgaaaacgcagcaaataacggctcggttgttgcccccgcaccgactttggtccgccggtgtcacg
aggccggcaccgggcccgaccgcgaccgcgggagcatctcccacccctgcaaagagccccccgcgtccgaccagcacgcc
gccatccacagggtcctgcgcgaggctggggacgaacttgagaggttgtaccagccggacttcacggagatgtcgcgcca
gctctatctcagctccaccacggcgcagaggaggttcgcggaggtgatagacgaactgtttcgggacggggtgaactggg
gccggattatcgctttcttcgagttcggaggcgcggtgtgcgcggagtgcgcggccaaggaggagatgagcccgcaggtg
gacaacatcgcggagtggatgacggaatatttaaatgggtccctgaacagctggatacaagataacgggggatgggtagg
tgtgattcagcgtcgctcccgttttcccagattaacacgggaattgggagacgctccgttagctgcacgccagcactttc
tgacccggaactcctctgctgacggacccaggcgttga
>gnl|bcl2dbcds|H2T3R0_uncBCL2L10-01 Putative BCL2-like 10 gene OS=[Eukaryota] Takifugu rubripes (length=1062 residues).
atggcctgtcgggagctccagaggggagaaactctggccagcctgaagcgggagagtgacaccctgaaaaagaagctgga
ggaggagcggggcaaactcaacgatgtggagttgcatcaggttgctgagaaggtcgatactttaggggcactgtcattga
agaccaaacgtgtgctgaaaggtcacgggaacaaagtgctgtgcatggactggtgcaaagacaaacgccgcctggtcagc
tcctctcaggatgggaaggtgatcctctgggatgcgttcactctcaacaaggagcacgctgtgtccctgccgtgcacgtg
ggtgttggcgtgtgcttatgctccgtcaggctgtgctgtggcgtgtggaggattggataacaagtgctgcgtgatcccgt
tgtcattggacaaaaatgagaacttggctgcaaagaagaaatctgtggccatgcacaccaactacgtgtcaggatgcagc
ttcgttaacaccgatatgcagatcctgacctccagtggcgacggcacatgtgccctgtgggatgtggagagtgggcagct
gttgcagagtttccacggtcacacagctgatgttttgtccctggatttcatcccatctgagacgggaaacattttcatct
ctgggggctgtgacaaaaaggccaacgtgtgggacatgcgctctggacagaacatccagtctttcgagaaccacgtgtct
gatgtaaactgtgtaaagttccaccccagcggtgatgcgttcgcctctgcttctgatgacgcaacatgtcgtttttatga
tctgcgagctgaccgagaggttgctgtctaccagaaggacagcatcatatttggtgcctcctccctggatttctctctga
gtggacgcctgcttttcactgggtataatgattacaccatcaacgtgtgggatgtcctgaagggatctcgggtgtctgtt
ctgtttggccacgagaaccgtatcagcagagtcagagtgtcacctgacggcacggctctctgctcggcatcctgggacag
caccttacggatttgggcctaa
© 1998-2018