Dataset for CDS MCL-1 of organism Takifugu rubripes

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H2RNY4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Takifugu rubripes GN=MCL-1 (length=690 residues).
gacagcccgaagcggcccagcaagctctccgtgatcgcacccaaggtttgcgtggcgaaggccatccaggaggacagcca
ggacaccgaccaccggtcggcgccgtgtacgccggagatgaactcggtgaacgggttggacgtgtccgggcgcccagcgg
aggacgaggcggcgttagacaacgacacgaggcagctcctcagctgcttcatggcggacttttgcggcatcggttcacat
cagtggagggagagcggagcgctgtcgaccatgaagcgagtggtggcgaacctgatggaaaagcaccgatacgtgtacaa
tgggatgaccaaacagttgaccctggacgacagaggagacgatgtgagcttcgtcagctcggtagccaaaagcatattcg
cagacggggtcaccaactgggggcgcatcgccagcctagtggcctttggagccgtggtggcccagcacatgaaggacaat
ggtcggagggactgcgtggagccggtggcgcaggagatctccacgtacctgttgacggaccggcgggactggctgatcaa
aaacaacggctgggaaggatttgtggagtttttccaagtatcggacccagagtcgtcagtcaggaacatgctgatggccg
tcgcgggggttgccgggctcggggccacgctggccctgttgatccggtga
© 1998-2018