Dataset for CDS BCL-2-like of organism Takifugu rubripes

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|H2RNY4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Takifugu rubripes GN=MCL-1 (length=690 residues).
gacagcccgaagcggcccagcaagctctccgtgatcgcacccaaggtttgcgtggcgaaggccatccaggaggacagcca
ggacaccgaccaccggtcggcgccgtgtacgccggagatgaactcggtgaacgggttggacgtgtccgggcgcccagcgg
aggacgaggcggcgttagacaacgacacgaggcagctcctcagctgcttcatggcggacttttgcggcatcggttcacat
cagtggagggagagcggagcgctgtcgaccatgaagcgagtggtggcgaacctgatggaaaagcaccgatacgtgtacaa
tgggatgaccaaacagttgaccctggacgacagaggagacgatgtgagcttcgtcagctcggtagccaaaagcatattcg
cagacggggtcaccaactgggggcgcatcgccagcctagtggcctttggagccgtggtggcccagcacatgaaggacaat
ggtcggagggactgcgtggagccggtggcgcaggagatctccacgtacctgttgacggaccggcgggactggctgatcaa
aaacaacggctgggaaggatttgtggagtttttccaagtatcggacccagagtcgtcagtcaggaacatgctgatggccg
tcgcgggggttgccgggctcggggccacgctggccctgttgatccggtga
>gnl|bcl2dbcds|H2SNZ9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Takifugu rubripes GN=BCL2L1 (length=657 residues).
atgtctcaaaacagagaactggtcattttctatattaagtacaaactctcccaaagaaattaccctttcaatcacaatgg
actcatattagagcctccaagtaggactgatgggcagtttgtaactactcagttcaatggaacttttaatggtgcaagcc
ctggaacacccccagcaacaagtctggcaacaagtctggatacagtaaaggaagccctccgggacacaggcaatgaattt
gagctgcgatacacttgtgctttcagtgacctgcacaaccagctacacatcaccccagctactgcttaccaaagttttga
gaatgttatggatgaggtatttagggatggagtcaactgggggcggatagtggggctttttgcatttggtggtgctctct
gtgtggagtgtgttgagaaggagatgagtcccctggtgggccggattatagagtggatgacagtctatcttgacaaccac
attcaaccatggatccagagtcaaggaggatgggtccgttttgctgaactctttgggcaggatgcagcagcagaaagcag
gagatctcaggagagattcagaaacggactcctggtggggatgagcctggcagcagggatcgcaatcgggtcgttcatag
tgaggaaactcctgtga
>gnl|bcl2dbcds|H2SNZ9_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Takifugu rubripes GN=BCL2L1 (length=606 residues).
cttgaaacagcaaggcttgaccaagacaagagcagaatcaccccagagcaaagtcaaaaagcgactgatgggcagtttgt
aactactcagttcaatggaacttttaatggtgcaagccctggaacacccccagcaacaagtctggcaacaagtctggata
cagtaaaggaagccctccgggacacaggcaatgaatttgagctgcgatacacttgtgctttcagtgacctgcacaaccag
ctacacatcaccccagctactgcttaccaaagttttgagaatgttatggatgaggtatttagggatggagtcaactgggg
gcggatagtggggctttttgcatttggtggtgctctctgtgtggagtgtgttgagaaggagatgagtcccctggtgggcc
ggattatagagtggatgacagtctatcttgacaaccacattcaaccatggatccagagtcaaggaggatgggtccgtttt
gctgaactctttgggcaggatgcagcagcagaaagcaggagatctcaggagagattcagaaacggactcctggtggggat
gagcctggcagcagggatcgcaatcgggtcgttcatagtgaggaaa
>gnl|bcl2dbcds|H2SNZ9_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Takifugu rubripes GN=BCL2L1 (length=543 residues).
atgtctcaaaacagagaactggtcattttctatattaagtacaaactctcccaaagaaattaccctttcaatcacaatgg
actcatattagagcctccaataaaggaagccctccgggacacaggcaatgaatttgagctgcgatacacttgtgctttca
gtgacctgcacaaccagctacacatcaccccagctactgcttaccaaagttttgagaatgttatggatgaggtatttagg
gatggagtcaactgggggcggatagtggggctttttgcatttggtggtgctctctgtgtggagtgtgttgagaaggagat
gagtcccctggtgggccggattatagagtggatgacagtctatcttgacaaccacattcaaccatggatccagagtcaag
gaggatgggtccgttttgctgaactctttgggcaggatgcagcagcagaaagcaggagatctcaggagagattcagaaac
ggactcctggtggggatgagcctggcagcagggatcgcaatcgggtcgttcatagtgaggaaa
>gnl|bcl2dbcds|H2U5I3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Takifugu rubripes GN=BCL2L1 (length=657 residues).
atgtcgtataacaacagagagctggtggagcacttcttaagatacaagctgtctcagaggaactacccaacttctctgct
gagaccagaggatactgatggaaggacagagggagaaaagaggagccccggtgcttccaatggcctgctggtccgcagca
ggaacaggggtggagcgtctccatccgcaggtgctggcatagaggctgtgaacgcagctcttcgggactcggcagaagag
tttgagaagctctttgctcaagcattcagcgacctctcctcacagctcgacatcactcctgacacagcttaccagagctt
taagaatgtgatggacgaggtgttcaaggacggagtcaactggggacgagttgtgggactatttgcctttggcggggtac
tatgtgtggaatgtgtcgagaaggatgcgagccaactggtttgccgcattgcagactggatgaccatttacctggatgag
catattaacccgtggatccagagtcaaggaggatgggattgcttcgcgaagatttttggggacgacgccgcggcagaggg
gaggagagctcgcgagaacctgagtagatggatgctgggcggattggcgctgctgatgggagttttggtcggcgctttca
tcgtcaagaaacattga
>gnl|bcl2dbcds|H2U5I3_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Takifugu rubripes GN=BCL2L1 (length=600 residues).
atgtcgtataacaacagagagctggtggagcacttcttaagatacaagctgtctcagaggaactacccaacttctctgct
gagaccagaggatactgatggaaggaacaggggtggagcgtctccatccgcaggtgctggcatagaggctgtgaacgcag
ctcttcgggactcggcagaagagtttgagaagctctttgctcaagcattcagcgacctctcctcacagctcgacatcact
cctgacacagcttaccagagctttaagaatgtgatggacgaggtgttcaaggacggagtcaactggggacgagttgtggg
actatttgcctttggcggggtactatgtgtggaatgtgtcgagaaggatgcgagccaactggtttgccgcattgcagact
ggatgaccatttacctggatgagcatattaacccgtggatccagagtcaaggaggatgggattgcttcgcgaagattttt
ggggacgacgccgcggcagaggggaggagagctcgcgagaacctgagtagatggatgctgggcggattggcgctgctgat
gggagttttggtcggcgctttcatcgtcaagaaacattga
© 1998-2018