Dataset for CDS BCL-2-like of organism Takifugu obscurus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A0F7L1T6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Takifugu obscurus GN=BCL2L1 (length=657 residues).
atgtcgtataacaacagagagctggtggagcacttcttaagatacaagctgtctcagaggaactacccatcttctctgct
gagaccagaggatactgatggaaggacagagggagaaaagaggagccccgctgcttccaatggcctgctggtccgcagca
ggaacaggggtggagcgtctccatccgcaggtgctggcattgaggctgtgaacgcagctcttcgggactcggcagaagag
tttgagaagctctttgctcaagcattcagcgacctctcctcacagctcgacatcactcctgacacggcttaccagagctt
taagaatgtgatggacgaggtgttcaaggacggagacaactggggacgagttgtgggactatttgcctttggcggggtac
tatgtgtggaatgtgtcgagagggatgcgagccaactggtttgccgcattgcagactggatgaccatttacctggatgag
catattaacccgtggatccagagtcaaggaggatgggattgcttcgcgaagatttttggggacgacgccgcggcagaggg
gaggagagctcgcgagaacctgagtagatggatgctgggcggattggcgctgctgatgggagttttggtcggcgctttca
tcgtcaagaaacattga
© 1998-2018