Dataset for CDS Unclassified of organism Taeniopygia guttata

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H0ZU95_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Taeniopygia guttata (length=111 residues).
ggctttgtggactttttccgcctggaggacctggagggcagcgtccggaacgttctgatggccttcgcgggggtggccgg
cctgggggccagcctggcctacctgatccgg
© 1998-2018