Dataset for CDS BCL2L1 of organism Taeniopygia guttata

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H0Z8G3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Taeniopygia guttata GN=BCL2L1 (length=687 residues).
atgtacagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagaaaggatacagctggagtcagct
ggaagaggaggatgagaacaggactgactttgcaggggaggaggacgagatggacggggtcctcaacgggagcccctcct
ggcacgcggccaccagccacatagtgaatggagccaccgtgcaccagaacagcctcgaagtccatgagatccgtcgagca
gctgatgtgaggcaggcgctgagagaggcgggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcacttc
ccagctccacatcactcccagcacagcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgttaaggagatgagggtattggtg
aaacgcatcgtctcttggatgaccacgtacttgaccgaccacttagatccctggatccaggagaatggcggatgggagcg
ctttgtggactctatgaacgatgctgctgccgagatgagaaaaggccaggagttcaacaaatggctcctgacgggggcga
cggtggccggagtgcttctgctgggatccctgctgagccgcaagtga
© 1998-2018