Dataset for CDS BCL-2 of organism Taeniopygia guttata

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H0YUX3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Taeniopygia guttata GN=BCL-2 (length=729 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctctcagagggg
atacgactgggctgccggcgaggacagggcatccctgcctccagatcactccgcttctgctgctgctgcgattgctgctg
ctgcgattgctgctgctgggacttctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctactgct
agccacacgcccccagccgaggggctgcgccctgcaccccaggccgtccacctcgtcctgcgccaggcgggggatgagtt
ctcccgacgctaccagagagacttttcccaaatgtctggccagctgcacctgacgccctttacagccaggagccgcttcg
tggcggtggtggaggagctcttccgagatggggttaactggggcagaattgtggccttcttcgagtttggcggtgtgatg
tgtgtggagagcgtcaacagggagatgtttcccctcgtggacaacattgccacctggatgactgagtacctgaaccggca
cctgcacaactggatccaggacaacggaggctgggatgcctttgtggagttgtatggcaacaatatgaggcctttgtttg
atttctcctggatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatcttgga
cataagtag
© 1998-2018