Dataset for CDS Unclassified of organism Sus scrofa

[Download (right click)]

7 sequence(s)

>gnl|bcl2dbcds|A0A286ZMU0_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Sus scrofa (length=513 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tactgatgtggaagagaacagaactgaggccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgaggtaccggagggcattcagtga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagctttgagcaggacacttttgtggaactctacggaa
acaatgcagcagctgagagccggaagggccaggagcgcttcaaccgatggttcctgacgggcatgactctagctggggtg
gttctgctgggttcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A286ZMU0_uncBCL2L1-02 Putative BCL2-like 1 gene OS=[Eukaryota] Sus scrofa (length=528 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tactgatgtggaagagaacagaactgaggccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgaggtaccggagggcattcagtga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagctttgagcaggagaacggcggctgggacacttttg
tggaactctacggaaacaatgcagcagctgagagccggaagggccaggagcgcttcaaccgatggttcctgacgggcatg
actctagctggggtggttctgctgggttcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A286ZMU0_uncBCL2L1-03 Putative BCL2-like 1 gene OS=[Eukaryota] Sus scrofa (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tactgatgtggaagagaacagaactgaggccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgaggtaccggagggcattcagtga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacggaaacaatgcagcagctgagagccggaagggccaggagcgcttcaaccgatggt
tcctgacgggcatgactctagctggggtggttctgctgggttcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A287A8D8_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sus scrofa (length=1014 residues).
atgctgctgctggctgccgccttcctcgtggcgttcgtgctgctgctctacatggtgtctccgctcatcagccccaagcc
cctcgccctgcccggagctcatgtggtggttactggaggctccagcggcatcggaaagtgcattgccattgagtgctata
aacaaggagcgtttataactctggttgcacgaaatgaggacaagctgttgcaggcaaagaaagaaattgaaaaacactct
attaatgataaacaggtggtgctttgtatatcagttgatgtgtctcaagactatagccaagtagagaatgtcataaaaca
agcacaggagaaactgggcccagtggacatgcttgtaaactgtgcaggaatgtcactttcaggaaaatttgaagatcttg
aagttagtacttttgagaggctcatgagtgtcaactacctgggcagcgtgtacccgagccgagcggtgatcaccaccatg
aaggagcgccgcgtgggcaggatcgtcttcgtgtcctctcaggccgggcagctgggcctgttcggcttcacagcctactc
ttcctcaaagtttgccatcaggggattggcagaagctctgcagatggaggtgaagccatataatgtttatgtcacagtgg
cctaccctccagacacagacacccctgggtttgccgaagaaaacaaaaccaagcctttggagactcgtcttatttcagag
accacatctgtttgcaaaccagagcaagtggccaaacaaattgttaaagatgccatacaaggaaatttcaatagttccat
cggctcagatgggtacatgctgtcctccctgacctgtggaatggctccagtaacttccatcactgaagggctccagcagg
atgcctttgtggagctgtatgggcccagcatgcggcctctatttgatttctcctggctgtctctgaaggcgctgctcagt
ctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A287A8D8_uncBCL2-03 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sus scrofa (length=807 residues).
atgctgctgctggctgccgccttcctcgtggcgttcgtgctgctgctctacatggtgtctccgctcatcagccccaagcc
cctcgccctgcccggagctcatgtggtggttactggaggctccagcggcatcggaaagtgcattgccattgagtgctata
aacaaggagcgtttataactctggttgcacgaaatgaggacaagctgttgcaggcaaagaaagaaattgaaaaacactct
attaatgataaacaggtggtgctttgtatatcagttgatgtgtctcaagactatagccaagtagagaatgtcataaaaca
agcacaggagaaactgggcccagtggacatgcttgtaaactgtgcaggaatgtcactttcaggaaaatttgaagatcttg
aagttagtacttttgaggtgaagccatataatgtttatgtcacagtggcctaccctccagacacagacacccctgggttt
gccgaagaaaacaaaaccaagcctttggagactcgtcttatttcagagaccacatctgtttgcaaaccagagcaagtggc
caaacaaattgttaaagatgccatacaaggaaatttcaatagttccatcggctcagatgggtacatgctgtcctccctga
cctgtggaatggctccagtaacttccatcactgaagggctccagcaggtggtcaccatgggccttttccgcactatcgct
ttgttttacctgggaagtttcgacagcatagttcgtcgctgcatgatgcagagagctagatcggaaattgcagacaaaac
tgcctaa
>gnl|bcl2dbcds|A0A287A8D8_uncBCL2-04 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sus scrofa (length=897 residues).
atgctgctgctggctgccgccttcctcgtggcgttcgtgctgctgctctacatggtgtctccgctcatcagccccaagcc
cctcgccctgcccggagctcatgtggtggttactggaggctccagcggcatcggaaagtgcattgccattgagtgctata
aacaaggagcgtttataactctggttgcacgaaatgaggacaagctgttgcaggcaaagaaagaaattgaaaaacactct
attaatgataaacaggtggtgctttgtatatcagttgatgtgtctcaagactatagccaagtagagaatgtcataaaaca
agcacaggagaaactgggcccagtggacatgcttgtaaactgtgcaggaatgtcactttcaggaaaatttgaagatcttg
aagttagtacttttgagaggctcatgagtgtcaactacctgggcagcgtgtacccgagccgagcggtgatcaccaccatg
aaggagcgccgcgtgggcaggatcgtcttcgtgtcctctcaggccgggcagctgggcctgttcggcttcacagcctactc
ttcctcaaagtttgccatcaggggattggcagaagctctgcagatggaggtgaagccatataatgtttatgtcacagtgg
cctaccctccagacacagacacccctgggtttgccgaagaaaacaaaaccaagcctttggagactcgtcttatttcagag
accacatctgtttgcaaaccagagcaagtggccaaacaaattgttaaagatgccatagtggtcaccatgggccttttccg
cactatcgctttgttttacctgggaagtttcgacagcatagttcgtcgctgcatgatgcagagagctagatcggaaattg
cagacaaaactgcctaa
>gnl|bcl2dbcds|A0A287A8D8_uncBCL2-05 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sus scrofa (length=717 residues).
atggcgcacgctgggagaacagggtatgataaccgggaaatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcgggcgccgcgtccccgggggccgctcccgcaccgggcatcttctcctcccagcccg
ggcgaacccccgctcccgccaggacctcgccgccgccgaccccgaccgcccccgccgccaccgccgccgccgccgccgcc
gcggggcctgtactcagcccggtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctctcgtcgcta
ccgccgcgactttgccgagatgtccagccagctgcacctgactcccttcaccgcgaggggacgctttgccacggtggtgg
aggagctcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagc
gtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctg
gatccaggataacggaggctgggatgcctttgtggagctgtatgggcccagcatgcggcctctatttgatttctcctggc
tgtctctgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
© 1998-2019