Dataset for CDS BCL-2-like of organism Sus scrofa

[Download (right click)] [Alignment] [Repertoires]

12 sequence(s)

>gnl|bcl2dbcds|A0A287APJ6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sus scrofa GN=BCL-2 (length=1014 residues).
atgctgctgctggctgccgccttcctcgtggcgttcgtgctgctgctctacatggtgtctccgctcatcagccccaagcc
cctcgccctgcccggagctcatgtggtggttactggaggctccagcggcatcggaaagtgcattgccattgagtgctata
aacaaggagcgtttataactctggttgcacgaaatgaggacaagctgttgcaggcaaagaaagaaattgaaaaacactct
attaatgataaacaggtggtgctttgtatatcagttgatgtgtctcaagactatagccaagtagagaatgtcataaaaca
agcacaggagaaactgggcccagtggacatgcttgtaaactgtgcaggaatgtcactttcaggaaaatttgaagatcttg
aagttagtacttttgagaggctcatgagtgtcaactacctgggcagcgtgtacccgagccgagcggtgatcaccaccatg
aaggagcgccgcgtgggcaggatcgtcttcgtgtcctctcaggccgggcagctgggcctgttcggcttcacagcctactc
ttcctcaaagtttgccatcaggggattggcagaagctctgcagatggaggtgaagccatataatgtttatgtcacagtgg
cctaccctccagacacagacacccctgggtttgccgaagaaaacaaaaccaagcctttggagactcgtcttatttcagag
accacatctgtttgcaaaccagagcaagtggccaaacaaattgttaaagatgccatacaaggaaatttcaatagttccat
cggctcagatgggtacatgctgtcctccctgacctgtggaatggctccagtaacttccatcactgaagggctccagcagg
atgcctttgtggagctgtatgggcccagcatgcggcctctatttgatttctcctggctgtctctgaaggcgctgctcagt
ctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A287APJ6_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sus scrofa GN=BCL-2 (length=717 residues).
atggcgcacgctgggagaacagggtatgataaccgggaaatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcgggcgccgcgtccccgggggccgctcccgcaccgggcatcttctcctcccagcccg
ggcgaacccccgctcccgccaggacctcgccgccgccgaccccgaccgcccccgccgccaccgccgccgccgccgccgcc
gcggggcctgtactcagcccggtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctctcgtcgcta
ccgccgcgactttgccgagatgtccagccagctgcacctgactcccttcaccgcgaggggacgctttgccacggtggtgg
aggagctcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagc
gtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctg
gatccaggataacggaggctgggatgcctttgtggagctgtatgggcccagcatgcggcctctatttgatttctcctggc
tgtctctgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A287AW74_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Sus scrofa GN=BCL2L2 (length=582 residues).
atggcgaccccggcctcagccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccagcagcgcttcacc
caggtctctgatgaactcttccaaggaggccccaactggggccgccttgtggccttctttgtcttcggagctgcactgtg
tgctgagagtgtcaataaggagatggagccactcgtgggacaagtgcaggagtggatggtgacctacctggagacacggc
tggccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A287AW74_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Sus scrofa GN=BCL2L2 (length=1002 residues).
atggcgaccccggcctcagccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccagcagcgcttcacc
caggtctctgatgaactcttccaaggaggccccaactggggccgccttgtggccttctttgtcttcggagctgcactgtg
tgctgagagtgtcaataaggagatggagccactcgtgggacaagtgcaggagtggatggtgacctacctggagacacggc
tggccgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaagtagagaagcagatgaatatgagtccaccaccaggcaatgctggcccagttat
catgtccattgaggagaagatggaggcagatgcccgatctatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagcacactttcatggctgtggttcagtcaaccgcgttactatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagctcgatacc
gtgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|C7F841_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Sus scrofa GN=BCL2A1 (length=528 residues).
atgactgacgacgagtttggatatattcacatgctggcccaggactatctgaagtatgtcctgcagataccacaacctgg
atctggtccaagcaaaacatctagagtgttacgagacgtggctttctccgtccaaaacgaagttgaaaagaatttgaaac
catgcttggacaattttgatgttgtgtccatagacactgccagaataatattcaatcaagtgatggaaaaggaatttgaa
gatggcatcattaactggggaaggattgtgaccatatttgcatttgaaggtattctcatgaagaaacttctgcgaaagcg
aattgccccagatgtggacacgtacaaggagatttcttactttgtcgccgagttcatcaccaaaaacacaggacagtgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacccaaatctggctggctgacctttgtggaagtt
acaggaaagatctgtgaaatgttatgtctcctgaagcaatactattga
>gnl|bcl2dbcds|C7F841_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Sus scrofa GN=BCL2A1 (length=528 residues).
atgactgacgacgagtttggatatattcacatgctggcccaggactatctgaagtatgtcctgcagataccacaacctgg
atctggtccaagcaaaacatctagagtgttacgagacgtggctttctccgtccaaaacgaagttgaaaagaatttgaaac
catgcttggacaattttgatgttgtgtccatagacactgccagaataatattcaatcaagtgatggaaaaggaatttgaa
gatggcatcattaactggggaaggattgtgaccatatttgcatttgaaggtattctcatgaagaaacttctgcgaaagcg
aattgccccagatgtggacacgtacaaggagatttcttactttgtcgccgagttcatcaccaaaaacacaggacagtgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacccaaatctggctggctgacctttgtggaagtt
acaggaaagatctgtgaaatgttatgtctcctgaagcaatactattga
>gnl|bcl2dbcds|F1RZB9_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Sus scrofa GN=BCL2L10 (length=555 residues).
atggcggacgcgttcagggagcgcacagcccggcttctgaccgactacctggagtactgcgcccgggagcccggcaccgc
cgcgcggcagccgtcctcgcccgaggccgcagtgctgcgttgcgtggctgcccagatacgggagtacaacgtgcgcacct
tgtctgtctaccgcggcttccgctggaaccgtgtcgaattggtggcctggatggcacagaaactactcgcaagcccacgt
ggccccaactggtaccgcgtggcatcactcttgaccttcgcagggatgctgctggaaagacatcctcgggaggcctgtgg
gcggaagaagaaggagggcaacgttagcagggactgccgactcctggtggctttgctgtgcgctcagctctcagggcagc
atcgcacctggctattggcgaacggcggctgggatggattttgtctcttcttccaaggttcattgcaacaaacttggaca
agacacatggtctgggtttttgtgtcatactgtacagcagtggtcttactctacttgtggagaaaattattgtga
>gnl|bcl2dbcds|K9IWB2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=1056 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggctacgggaaaagaggccacggcccggcaagaggtagggggaggggaag
ccggcatggtgattggcggaagcgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacccgcctcgcgtc
gccgcctgaagagatggaatccccggcctccgacgccatcatgtctcccgaagaggagctggacgggtacgagccggagc
ccctcgggaagcggccggccgtcctgcccttgctggggttagtcgaggaggccagtagtggccccggcacggacggctcg
ctcccctcgacgccgcccccggcagaggaggaggaggacgagttataccggcagtccctggagattatctctcggtacct
tcgggagcaggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccgttagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggc
atatctaataagatag
>gnl|bcl2dbcds|K9IWB2_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=1008 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggctacgggaaaagaggccacggcccggcaagaggtagggggaggggaag
ccggcatggtgattggcggaagcgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacccgcctcgcgtc
gccgcctgaagagatggaatccccggcctccgacgccatcatgtctcccgaagaggagctggacgggtacgagccggagc
ccctcgggaagcggccggccgtcctgcccttgctggggttagtcgaggaggccagtagtggccccggcacggacggctcg
ctcccctcgacgccgcccccggcagaggaggaggaggacgagttataccggcagtccctggagattatctctcggtacct
tcgggagcaggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccgttagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
catgtagaggacctagaaggcggcatatctaataagatagccttttaa
>gnl|bcl2dbcds|K9IWB2_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=1056 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggctacgggaaaagaggccacggcccggcaagaggtagggggaggggaag
ccggcatggtgattggcggaagcgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacccgcctcgcgtc
gccgcctgaagagatggaatccccggcctccgacgccatcatgtctcccgaagaggagctggacgggtacgagccggagc
ccctcgggaagcggccggccgtcctgcccttgctggggttagtcgaggaggccagtagtggccccggcacggacggctcg
ctcccctcgacgccgcccccggcagaggaggaggaggacgagttataccggcagtccctggagattatctctcggtacct
tcgggagcaggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccgttagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggc
atatctaataagatag
>gnl|bcl2dbcds|O77737_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sus scrofa GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tactgatgtggaagagaacagaactgaggccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgaggtaccggagggcattcagtga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagctttgagcaggtattgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacggaaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgatggt
tcctgacgggcatgactctagctggggtggttctgctgggttcgctcttcagtcggaaatga
>gnl|bcl2dbcds|Q95KR3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=459 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtcc
acgttttaagtgacggagtaacaaactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttg
aagagtataaatcaagaaagctgcatcgaaccgttagcagaaagcatcacagatgttctcgtaaggacaaaacgagactg
gctagtcaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgc
tgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatag
© 1998-2018