Dataset for CDS BCL2A1 of organism Sus scrofa

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|C7F841_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Sus scrofa GN=BCL2A1 (length=528 residues).
atgactgacgacgagtttggatatattcacatgctggcccaggactatctgaagtatgtcctgcagataccacaacctgg
atctggtccaagcaaaacatctagagtgttacgagacgtggctttctccgtccaaaacgaagttgaaaagaatttgaaac
catgcttggacaattttgatgttgtgtccatagacactgccagaataatattcaatcaagtgatggaaaaggaatttgaa
gatggcatcattaactggggaaggattgtgaccatatttgcatttgaaggtattctcatgaagaaacttctgcgaaagcg
aattgccccagatgtggacacgtacaaggagatttcttactttgtcgccgagttcatcaccaaaaacacaggacagtgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacccaaatctggctggctgacctttgtggaagtt
acaggaaagatctgtgaaatgttatgtctcctgaagcaatactattga
>gnl|bcl2dbcds|C7F841_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Sus scrofa GN=BCL2A1 (length=528 residues).
atgactgacgacgagtttggatatattcacatgctggcccaggactatctgaagtatgtcctgcagataccacaacctgg
atctggtccaagcaaaacatctagagtgttacgagacgtggctttctccgtccaaaacgaagttgaaaagaatttgaaac
catgcttggacaattttgatgttgtgtccatagacactgccagaataatattcaatcaagtgatggaaaaggaatttgaa
gatggcatcattaactggggaaggattgtgaccatatttgcatttgaaggtattctcatgaagaaacttctgcgaaagcg
aattgccccagatgtggacacgtacaaggagatttcttactttgtcgccgagttcatcaccaaaaacacaggacagtgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacccaaatctggctggctgacctttgtggaagtt
acaggaaagatctgtgaaatgttatgtctcctgaagcaatactattga
© 1998-2018