Dataset for CDS BCL-2 of organism Sus scrofa

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A287APJ6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sus scrofa GN=BCL-2 (length=1014 residues).
atgctgctgctggctgccgccttcctcgtggcgttcgtgctgctgctctacatggtgtctccgctcatcagccccaagcc
cctcgccctgcccggagctcatgtggtggttactggaggctccagcggcatcggaaagtgcattgccattgagtgctata
aacaaggagcgtttataactctggttgcacgaaatgaggacaagctgttgcaggcaaagaaagaaattgaaaaacactct
attaatgataaacaggtggtgctttgtatatcagttgatgtgtctcaagactatagccaagtagagaatgtcataaaaca
agcacaggagaaactgggcccagtggacatgcttgtaaactgtgcaggaatgtcactttcaggaaaatttgaagatcttg
aagttagtacttttgagaggctcatgagtgtcaactacctgggcagcgtgtacccgagccgagcggtgatcaccaccatg
aaggagcgccgcgtgggcaggatcgtcttcgtgtcctctcaggccgggcagctgggcctgttcggcttcacagcctactc
ttcctcaaagtttgccatcaggggattggcagaagctctgcagatggaggtgaagccatataatgtttatgtcacagtgg
cctaccctccagacacagacacccctgggtttgccgaagaaaacaaaaccaagcctttggagactcgtcttatttcagag
accacatctgtttgcaaaccagagcaagtggccaaacaaattgttaaagatgccatacaaggaaatttcaatagttccat
cggctcagatgggtacatgctgtcctccctgacctgtggaatggctccagtaacttccatcactgaagggctccagcagg
atgcctttgtggagctgtatgggcccagcatgcggcctctatttgatttctcctggctgtctctgaaggcgctgctcagt
ctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A287APJ6_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sus scrofa GN=BCL-2 (length=717 residues).
atggcgcacgctgggagaacagggtatgataaccgggaaatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcgggcgccgcgtccccgggggccgctcccgcaccgggcatcttctcctcccagcccg
ggcgaacccccgctcccgccaggacctcgccgccgccgaccccgaccgcccccgccgccaccgccgccgccgccgccgcc
gcggggcctgtactcagcccggtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctctcgtcgcta
ccgccgcgactttgccgagatgtccagccagctgcacctgactcccttcaccgcgaggggacgctttgccacggtggtgg
aggagctcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagc
gtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctg
gatccaggataacggaggctgggatgcctttgtggagctgtatgggcccagcatgcggcctctatttgatttctcctggc
tgtctctgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
© 1998-2018