Dataset for CDS Unclassified of organism Suberites domuncula

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|Q5TJD7_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Suberites domuncula (length=657 residues).
atgacaaccgagtcaccatcactacatggctcatctgggggtaataacaacagagaaagggtggacaataactatggcct
gcctgatgacatgactatagacaacgaacacatagaggagctggcacgctcttacattgttaatttgttgaggagagaag
gtctcaatcacatagccgaccaatttgcacccgtgggatcgactagagctaatggctaccagctcattgagaggatcgta
tgtcaattggaggatgaacgttcgcagcagtttatcgatattctaagaggtctggaaattgaccaacagaatctacggat
aacataccagacaatagtaggggagatctttaatgatggtgttcactgggggcgtatagtagcatttctagtgttttctg
gccatctagctgtgcattgtgctcgcagcaatggtttggagaatagagtgagagatgtggtagaatggacagaagctgag
atgagactgcgtgtgcatcaatgggttgaagaccgaggaggatgggaggcattcattcaacactttgatagaaatacctt
gtggaattttgacttgtccacaatagcggtatctgctgcgatgatagctgctctgtttgcagctggtctgtttacagtaa
aaaggtttttgagttga
>gnl|bcl2dbcds|Q9N754_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Suberites domuncula (length=657 residues).
atggccgaagctttgttgacaaccataagtatgacacatccagacaatgactcggagcttattcttgtcatgcaacagag
tgcttgtctaagttatcacttgacctactatctcctaaatcaaggtgggataaaactaaatggttatgctggcaacggga
gaacctctcatacgaggaacagactaaccaacgataagaaattcagagaagcaatttcaactctcgagtccagctgtaaa
caaatgaaaagcaaatatcagcaagagattgaaggattggttaaaactttagacatttccgacacacaattatatactaa
ctttcagcacgcagctaattcattaatggacggggacattagatggggaaggatcgctgtgttattcttttttacgagtg
tcttggctaaacgtcttcataaggacggacactcgcaccagatatcaagtcttatcggatggttaacgacattcttaaac
gataatgcaacttcgtggattctagaaaatggcggatgggcagcaataaaggattcagtaaacgttgaagaaaaacaaca
accgccaacagttgagaaagcacaaaagtctagttggctaacgatagcggctgtcggagtgggagccgtggttgtgggtg
ccctagctatcagataa
© 1998-2018