Dataset for CDS Unclassified of organism Strongylocentrotus purpuratus

[Download (right click)]

3 sequence(s)

>gnl|bcl2dbcds|W4Y4Z4_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Strongylocentrotus purpuratus (length=675 residues).
atgactgaatcaattcttgccgcttcttcgcctcagaaaagcaactacaacaagcagttgggccaaaacttgtttttcaa
tggaaatgttagaaaggaacagccacccagccctgatgaagaagtgaatggacatcctcttgtggaggaaggcgagtcgg
ggttaattgctcgacagcttggggacgattacatttcatacaaagttggaaaacaacatggtcgccgaccgccttgccag
catgcagagacattaaggagagttggggatgaagttgaggaaagatacgccatcaccctcaatggtttagtgaacaattt
ggagtatgatccggacaaagatggtgaagaggcatttactgcgagtttgaatgccatgtttgaagaagggtcatgtaact
ggggacgtgttgttatggtttatgtttttgcagcccgtctcgcgaaatattgccaggaaaatggaaaaggttatcacgta
ggaagcttggcagattttgctggaagatatgttgcatcaaggttaaccccctggattaataagcaaggaggatgggaaaa
gtttgatgaaagtttcaaggccaaagactggaaagaaaaggcagcattcaactcgttgttagtgacaggggcttttcttg
gtggacttgccgcgctcagactattgatgaaatag
>gnl|bcl2dbcds|W4YMX7_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Strongylocentrotus purpuratus (length=498 residues).
atgccactttggaaatggatctgtaaaacgacttttatagatctgtcaaagttacggatgaatgatagtgaaaccactaa
actgattgaggattactgcatacacaggatacgaaaggagagcatcgaacttgcgtcttaccaacatgtgagcagagagc
cctatgctcccgtcgcagccagaatgagagaaataggtgtaacatggggaaggatagcagctttaatagcgttcagcggc
cgactttctgtacattgtgctagtaataacttagaagacttagttcccagtattataggctggacatccagatacattgg
cagtaaattattaccgtggatgcaagaccatcaaaattgggatgggttcatggcattttttgaggagaatggcaaagtcc
gggcgagggaaaccgtctcgtcgatcatgtcgtcggcgtgccgcttcgcagttttcggcgcgggaatcgcagccctcgct
tgcctactcagaagatag
>gnl|bcl2dbcds|W4Z8J6_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Strongylocentrotus purpuratus (length=462 residues).
atgccagatatcagcacagcaagcatagttgcagattatctacgttacagactgcaatgtttgggaaatggtgttgatgc
agaggaaaatgattgcttgtcaaccgtcatgtcatcagtcgaaaatgttccagaggatcttcatgaagccatcgtaaatc
tctccgaaaaactcatgaatgactacagagattctttcagtgatatgccaaatcaactgaaaattactgaaaatactatc
agttcgacatttaaggccgttacaagtgagctttttgtagatggtgttatttcttggggacgaattgtagcatttttctc
tttcggaggagccctgtgcgagtggtgtcaagagaaggacatcccccgggcgttccccacggttgaagagctgatggtcg
cctacatcaattctcatctcatcacatggattcatgcgaatggcggatgggtaatgaaataa
© 1998-2018