Dataset for CDS Unclassified of organism Strigamia maritima

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|T1JCZ5_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Strigamia maritima (length=615 residues).
atgggcgataacaggacggtggaaatgaacgaagaaacgcgctccctagttcaagactttattattcatagcatggagga
gcgcggcgttgcagttccacaaccgccattgcgttcgccgacgccactgagtaggaaattgcgccaagtgacgtgcgaat
tcgaacagaaaaataggacgtcgctggacgaaatgtttgtgacactgcaagagcagggaaaccagcaaatggaagtgaat
gcgcacttggcgttccagggagtcatcaatgaactgtttcgtgagggcatcacctggagccggattgtggcgatgttcgc
gttcgcgggtggcctcgccgtccgattcacgcaggacttggaccagatcgtcgaagacctcacccaattcatcgagcaca
ctttacagtcttggatcgccgataatggcggttgggtaaggcaacatatgcgacttttgtttattgttggattcgcctcg
gccagaacgaacgcattctcgtggaacaggaacaacattcctggcatatcagatgggttctcgaaaatgcgaattatttt
atcattttcgattatcgattggtctgaaattcgctttttcgggtttgttacgtaa
© 1998-2018