Dataset for CDS Unclassified of organism Stegastes partitus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3B5AUF2_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Stegastes partitus (length=618 residues).
ggggcgatggctgcagcctacagcagctgcgacattgtggaggattacctgcactacaagctgctcagcaggggcgtggc
ctggcgctgctcgccgccgcccggcaggacaggtggtcggaggccggggcgagctgaaacatcacacctgcaaggcgaga
aggccgtcactgttgtcatggccgcgctgcggagcgcgggtgatgaggtggcgcgctgttgccatggtaacctgtgggcc
cacgtgtcggcgctgcggctgtgtgagggcggcgcggtgcagcggcgcagcctggaggcggtcagcgaggagctcttcag
ggacggcgtgaactggggacgcatcgtggccatgatggagctgggcggagctctgagcgccgaggctgctgaggctggag
acatgcgtcaggtggacgccatcgccggctggatggaggacagtctggactcgctgccactccgagggtggattgaagac
aatggaggatgggatgcctttgtgcagctgtatgagtccagacctccagtcagcttctggtccctgagggctgtgtttgg
actggttgtactgggagcagttgggatcacactgggagccttgttcacccagaaataa
© 1998-2019