Dataset for CDS BCL-2-like of organism Seriola lalandi dorsalis

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A3B4WGF4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Seriola lalandi dorsalis GN=BCL2L10 (length=573 residues).
atgtcatgcgggctgtggaaagagacccgggctgtggcagaggactacctgttcctttgctgcacaagcccacagccagc
ccctccacctcccagcgaatcagccgctgccatgagaggcatggcccaagacatggagacgcagcaccaggctcgcttcc
acacccttgctcaaacctttgtaacgcagtgtgggctggacccctgctccagcctcaggaaggtgatggaggagctggtg
ggagatggacacttgaactgggggagggttgtttccattttcacctttactggggtgctggccagactgctgctggagca
gaaccgtgtgaacccggggctggaccctgggcagggacaggggctcagaaactgcaggggactggcagagaccatagctg
attacctgggagaagagaagaaagactggctgctggagaacggtggatgggaggggttctgtaagttctcccacagtgcc
agagaggtgagccaggacttgtcgatgaagacagcactatttgctgctgctggtgtgggcctcgctggactcacctttct
cctggtgcgctag
>gnl|bcl2dbcds|A0A3B4XKA5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Seriola lalandi dorsalis GN=MCL-1 (length=858 residues).
atgaatcttatccaggcaccgaaacaggccgctttaaccgccgtgaactattgcatttgtcgtcaaaatggaggattgga
gacttggagggacagctccggagactcctcgccggagattgccattggctctacattatgttgtgacaacgggaatgttg
tgccaaatgataattctaaacggcccaagagcctggaagtcacctcaacaaatgggtatgcaacaaaagcgagtcgggag
gacagcgacgtcgacgacggctctttgccgtgtactccggagatgcagtcggatggcgaaaccgacgtccctagttgtcc
agctggggaagtgttggagtccgatacgagtcaactcattagccagtccatgaaaagctttaccggacggtcgatacagc
ggcggactgaacacagagcactacaaacaatgaagagggttgtggaaggcgttttggaaaaacacagatacgcatacaat
ggtatgatcaacaaactgtcactggacaacagaggggatgatgtgaggtttgtcggtgcagtagcgaagagcctgttcgc
agatggcaccacaaactggggtcgcatcgccagcctggtggccttcggggtggtggtgtgtcagcacatgaaggacacag
gcagggagaactgtgtggaatctgtggggcaggagatctccaaatacctgctgtctgatcagcgagactggctggtgaaa
aacaactcctgggatggatttgtatcgttctttcgagtagcagacccagagtctaaagtgaggaacacactcatggcctt
tgctggatttgcgggaatcggcgcaacactggccctgttgatcagcgccatgatgtga
>gnl|bcl2dbcds|A0A3B4XS24_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Seriola lalandi dorsalis GN=BCL2L1 (length=666 residues).
atgtcgtacagcaacagagagctggtggagttcttcataagctacaaactgtctcaaagtaactgcccaacctcactgct
gaggccagaggatgctggtggaaggactgagggagacaaggccagctcagctgccagtaatggcttgttggtcaacagca
gtgacaggtgtggtcagcccgggacgtcctcgcccccgcatggtggcatagaggccgtaaagtcagcccttaaggactct
gctgacgaatttgaattgctcttcaaccaagcatttagtgacctttccacgcagcttgacatcactcctgacactgcata
ccacagctttaagagtgtgatggatgagttgttcaaggatggagtcaactggggacgtatagtgggcctgtttgcctttg
ggggtgtactgtgtgtggaatgcatacagaagaatatgagcgagctggtttcccgtatcgcagactggatgaccatgtac
ctggatgagcacatcagtccgtggatccagagccaaggaggctgggactgctttgctgagatgtttgggcaagacgccgc
tgcagaagcgaggagatctcgggaggctgtgaggaggtggctgctagttggagtggcgatgttggcaggagtgctgatgg
gcgtgctcatcgttaagaaacattaa
>gnl|bcl2dbcds|A0A3B4XU17_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Seriola lalandi dorsalis GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtcgttttctacataaagtataagctctcccagagaaactatcctctcacccacatgga
actcaatgagtctcccaacaggactgatggcggggaggcagggttggttgaggaacagcggatagcgacgcacgccaatg
gaacttttaatggcacgagtcctgggacccgtccagagtccccgcagcggcagcaacggctgccgtcaacaacgagcctg
gacgcagtgaaagaggccctccgggattccgccaacgagtttgagttgcgatactcccgcgccttcagcgatctgcacaa
ccagctgcatatcacgccggccacagcttaccaaagctttgcgaacgtgatggatgaagtgttccgggatggcttcaact
ggggccgcatcatagggctttttgtgttcggcggggcgctgtgtgtcgagtgtgtggagaaggagatgagtcctctggtg
ggcaggatcgtagagtggatgaccgtctacctggacaaccgcattcagccatggatccagagtcaaggaggatgggagcg
atttgctgaaatctttgggcaggacgcagcagcagacagcaggaggtctcaggagagttttaagaagtggctgctggcgg
ggatgaccctggtgaccggggttgtggtgggctcactgatcgcccaaaagcgcctgtga
>gnl|bcl2dbcds|A0A3B4YAG2_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Seriola lalandi dorsalis GN=BCL-2 (length=687 residues).
atggcgagcgagtataatcgcaatattgtggaaaagtacatctgccataaactctccaaacggggatacgtgtggggatt
tgatgatgtccgagatgaagatgctgctaataatggctcaatagttgcccctccaccgactttggtccgccggtgccgtg
aagccaacaccgggcctgacaacgacagctcacctaacctctgcagacggctctctcagtccgacccgcacgccgagatc
cacagagtcctgcgcgaggctggagacgaacttgagagattataccagccggacttcacggagatgtcgcggcagctcta
tctcacctccaccacggcgcagagaagattcgccgaggttatagacgaactgttccgggacggggtgaactggggccgga
ttatcgctttcttcgagttcgggggcacggtgtgcgttgagtgcgcggccaaggaggagatgacatcgcaggtggacaac
atcgtggagtggatgacggagtatttaaatggacctcttaacagctggataaaggataacgggggatgggatgcctttgt
ggagctgtatgacagacagagggagtccgtcttcagttgctcctggccctccatcaagacagtcttcggcctggctgcac
tcggggcagcgagcctcaccatcggagcataccttacacagaagtga
© 1998-2019