Dataset for CDS BCL2L10 of organism Seriola lalandi dorsalis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3B4WGF4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Seriola lalandi dorsalis GN=BCL2L10 (length=573 residues).
atgtcatgcgggctgtggaaagagacccgggctgtggcagaggactacctgttcctttgctgcacaagcccacagccagc
ccctccacctcccagcgaatcagccgctgccatgagaggcatggcccaagacatggagacgcagcaccaggctcgcttcc
acacccttgctcaaacctttgtaacgcagtgtgggctggacccctgctccagcctcaggaaggtgatggaggagctggtg
ggagatggacacttgaactgggggagggttgtttccattttcacctttactggggtgctggccagactgctgctggagca
gaaccgtgtgaacccggggctggaccctgggcagggacaggggctcagaaactgcaggggactggcagagaccatagctg
attacctgggagaagagaagaaagactggctgctggagaacggtggatgggaggggttctgtaagttctcccacagtgcc
agagaggtgagccaggacttgtcgatgaagacagcactatttgctgctgctggtgtgggcctcgctggactcacctttct
cctggtgcgctag
© 1998-2019