Dataset for CDS Unclassified of organism Schmidtea mediterranea

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|C9WPR4_uncBCL2L1-02 Putative BCL2-like 1 gene OS=[Eukaryota] Schmidtea mediterranea (length=555 residues).
atgtcttatgttaaaactatgacactaaattatgatgataaagattacattcattctttgctcaacggtcttgttaaatt
agcaggcatagatcaacagcttaatgatcgaaactgtctaaatgatgatatagtacaatgcttgcacagtttggtggtag
aagctcaagaccgtggtaaagatacaatatctaatttttcatcgattttaaataaacctacggatgatgataaaaaacag
tcgttttatattgtggtggaatctttatttaacgattgtatacggtggtccagagtaatagtagcttttatgtatataat
tcaagttctcaaaatttcgaaaaatgaatacaaaaaatattttgagtggtcagttgagttgatcctaaccaaaatatatc
catgggtcagagaaaatggaggatgggagcaaatagtacagatatcgaaaaaccgaaaccacctcgaagaagtcacagaa
acaatgaaacaattcggcaaagtggccctggggataactggtttgtttgcattgggaaaatggatattcaattga
>gnl|bcl2dbcds|H2DL19_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Schmidtea mediterranea (length=579 residues).
atggaagatcgaatcatttttcaacccagtggtcttttaaaggattctagagtttacaatatcgaatgcgacctagattt
cttgccccctatcgacatcattgacaagattatgattgattttgttatgtatagaattagcatccgaggatttccggatt
tgaacatattcccaaacaaggttggaagaactaagtaccattccgttacaaatgagattctaaacaaattgactgacaag
gcagatgaattcgaaaggcaatattatccaagatttgaaaatcgaaaaagtctgttagaaaaaattcctgaaagagcatt
tttagattttattgacactcttcatggcattttcgaagataatcaaattaattggggcagaattattggctacttcacgt
ttgtagggtcgtattgtacggcctgcattgagcatggaatggtcagaattgtatacaatttagtggaatatgcaataaaa
tatatgaatacaaatctctccggttggatgtcaagcaatggtggatggcgaggacttggaatggctttatcaaccgaatc
atttgaattaagattctga
© 1998-2018