Dataset for CDS Unclassified of organism Schistosoma mansoni

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|G4VMZ9_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Schistosoma mansoni (length=897 residues).
atgcctcaaaatgaaattcaacctacaagtaatgaaccatctgctactactaataccaccacactaccatccacttctct
tgtatatcatcaatctcatcagtcagttccgtcaacatttatatctgcacgattaattctatgcgccagaaatctcgctg
accattttgagtctagatatcgtgatttattacaatccattaatcgagatgtagcgcgtttaaataatgatcaaagttgt
acagaagatacaaacaaaacgacaatgattagtgttaatgataatgttactaatgtgcgtgataccaacacaagtgtaaa
gagtgatagtaggattggtgatggtgatgccagcggtgctgctagtcatgtgagcgatgattcacttcaaactcgtttag
aaatggcacgatgtcaatttcatagtgttctagaagaattatttcttgagcgtattaactggggtcgtataattgcaatg
ttggcatttttgcgaacattatgtgaagttgttgaagagaacaataaacatatgaattattcagtttcacatcagtcagt
tccacagtctcatgatgtttcaaagtcaactgatttgcctattatttcttgtgaacaacttgagcataatgatgatgtta
catctgattgtaataaacagttatcttctactgatccatctgcttcctgcagtgataaaaatacggataaaaaattacaa
gataaagatttggaaacttccatggatcctcatcagtcgaatgttagtaacttacatttaatgtcgttcacaagaccttg
tgcagctgattatactttgtggacagttgagtttatacatggtccccgaggactttggaattggatatcatctcatggaa
attgggtgagcaaatag
>gnl|bcl2dbcds|G4VMZ9_uncBCL2L1-02 Putative BCL2-like 1 gene OS=[Eukaryota] Schistosoma mansoni (length=933 residues).
atgcctcaaaatgaaattcaacctacaagtaatgaaccatctgctactactaataccaccacactaccatccacttctct
tgtatatcatcaatctcatcagtcagttccgtcaacatttatatctgcacgattaattctatgcgccagaaatctcgctg
accattttgagtctagatatcgtgatttattacaatccattaatcgagatgtagcgcgtttaaatagtaattccaatagt
gataatattaatcataatatagatgatcaaagttgtacagaagatacaaacaaaacgacaatgattagtgttaatgataa
tgttactaatgtgcgtgataccaacacaagtgtaaagagtgatagtaggattggtgatggtgatgccagcggtgctgcta
gtcatgtgagcgatgattcacttcaaactcgtttagaaatggcacgatgtcaatttcatagtgttctagaagaattattt
cttgagcgtattaactggggtcgtataattgcaatgttggcatttttgcgaacattatgtgaagttgttgaagagaacaa
taaacatatgaattattcagtttcacatcagtcagttccacagtctcatgatgtttcaaagtcaactgatttgcctatta
tttcttgtgaacaacttgagcataatgatgatgttacatctgattgtaataaacagttatcttctactgatccatctgct
tcctgcagtgataaaaatacggataaaaaattacaagataaagatttggaaacttccatggatcctcatcagtcgaatgt
tagtaacttacatttaatgtcgttcacaagaccttgtgcagctgattatactttgtggacagttgagtttatacatggtc
cccgaggactttggaattggatatcatctcatggaaattgggtgagcaaatag
© 1998-2018