Dataset for CDS Unclassified of organism Salmo salar

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|B5X106_uncBCL2L10-01 Putative BCL2-like 10 gene OS=[Eukaryota] Salmo salar (length=591 residues).
atgtcatgcgggctgtggaaagaaaccctggctatagcagaggactacctgtctgtctgcagtattatccctgccagtgg
gtcctggaaagccccgcccggtcctcctcccagcgactcggctgcagccatgcggcgccaggcccgggacatggaggcca
agcaccgggcccgcttccacgccctggcacacagctttctgtgccaatgcgggccggacccctgcgcctgtctgaggagg
gtgatggaggagctggtgggagacggacagatgaactgggggagggtggtctctctgttcaccttcactggtgtgctggt
cagagaactacagggagaggacatggaccaggggctgggtaatggcatgggcctgggggggaaggagagctgcagggcac
tggcggagaccatagcagactacctaggagaggagaagagtgactggatgctggagaacaaaggctgggagggcttctgt
aagttcttccacacagcaagagaggtgaaccaggactcgtccatgaagactgccctgtttgctgctgctggcgtgggcat
cgcagggttaaccttcctcctggtccgctaa
© 1998-2018