Dataset for CDS BCL-2-like of organism Salmo salar

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|B5XAY3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Salmo salar GN=BCL2L1 (length=687 residues).
atgatgacttacaacaacagagaactggtggtgtactatattacctataaactatcacagagggactaccccttcaacca
catggagctcacggaagcccagaatcggactgaggtgggacaggtggaagggggtgcggcagtcctaacatacgtcaacg
ggacgagtcccgggactccaccaccacggcagtcgcccccctcctcccctcggcggacagcgggcctggacgcagtgaaa
gaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagcgttcagtgacctgtcctcccagctacacat
cacgccgtccacagcctaccagagctttgagaacgtgatggacgaggtgttccgggacggtgtcaactggggacgggtgg
tgggcctgttttccttcggaggggccctctgtgtagaatgtgtggacaaggagatgaaccccttggtgggaaggatcaca
gactggatgaccgtctacctggacaaccacatccagccctggatccagagccaaggaggatgggaccggtttgcagagat
ctttggaatggacgctgcagccgagagcaggaagtctcaggagagctttaagaagtggcttctggcagggatgaccctgg
tcacaggagtcgtcgtagggtcactcttcgctcagaaacgcctgtga
>gnl|bcl2dbcds|C0HAD8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Salmo salar GN=BCL2L1 (length=651 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctatagactgtcccagaggaattattcatgttgtcaatt
ggggctggagggtgcaagtggacggactgagggagatgacgccattgcaaatgggtctgtggggaacagcagaagcaatt
tggcgaagccctcatctccacaggggggcatggagccagtgaaagcagcactacgggactcagtggatgagtttgagctg
cgctacacccgcgccttcagtgacctctcctcccagctccacatcacccctgccacagcctaccacagctttgagagtgt
gatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggtctgtttgctttcggcggggccttgtgtgttg
agtgtgttgagaaggatatgagcccactggtggcgcgcatcgcagactggatgaccacctacctggacaaccatatccag
ccctggatccagagccaaggaggatgggaccgttttgcagagatctttggcagagatgctgctgcagacgttcgacggtc
tcaggagagcataattaaatggctgctagttggggtgattctgctttcaggagtgctggtcggcactctcatcatgaaga
aacgccagtga
>gnl|bcl2dbcds|Q0KFR9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Salmo salar GN=MCL-1 (length=858 residues).
atgagyctgtcgaactcgattacacgagccacaactacgatgttgcattttcaaaatggaggatcttcgtacctagctga
tgatgctaggccgttgtactatttccagggggctggggccatatgtgctggggcgtcaccgaagtctaaagtggacttgg
gaaatgggactggcgatactccaccacgacccacgacgttaggagtgaatgtcgtgaaaagcaacggccttgataatcat
ttgtctgaccgaagcaacaatgacgactctttgccgtgcactccccagatggcgtcagaatgtgggcctgaactatcgaa
ttgtccatcgggcgatgaagtattggaacatgataccagacaactcattgagaattttttgggggactacacaggactgt
ctcagcctcgatggacgcaaagcaagcctcttacgacgatgaagcgagtggtggaggacgtaatagcaaagcaccgatac
gcatacaatggtatggtcgccaaacttgacttggatgaccgatgcgatgacatgggcgtcatcaattctgtggccaagac
catgttcagtgacgggatcacaaactggggtcgcatcgccagcctggtggcatttggagcagtggtgagccagcacctga
aggagaggggcaggggacactgcgttgagttggtgggccaagagattgccaaatacctcctctctgaccaaagtgactgg
ctgatcaaaaacaatgcttggaatggatttgtagagttctttcatgtacaagatcctgagtcctcagtaaggaacaccct
cctagcctttgctggagttgctggaattggggcaacactcgccatgttcatcaggtga
© 1998-2018