Dataset for CDS BCL-2-like of organism Saimiri boliviensis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|E2IV77_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Saimiri boliviensis GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccagcctggcacctggcggacagccccgcggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcaataaagcaagcactgagggaggcaggcgacgagtttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcgtatcaaagctttgaacaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaa
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcagcagccgagagcagaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactctttagtcggaaatga
© 1998-2018