Dataset for CDS BCL-2-like of organism Saimiri boliviensis boliviensis

[Download (right click)] [Alignment] [Repertoires]

13 sequence(s)

>gnl|bcl2dbcds|A0A2K6TIT7_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L10 (length=687 residues).
atggctgacccgctgcagcagcgcaccgagcagctggtggcggactacctggagtactgctcccgggagcccggcacccc
cgagtcgccaccggccacggccgaggccgctgtgctgcgcgccacggccgccgttgtacggaaactctacccgtccttct
tctccgcttaccgcggctaccccaggaaccgcgtcgagctggtggcgaggatggcggaggccttgctctccgacagtccc
ggtcccacctggggcaacgtggtgatgctcctggccttcgcggggacgctgctagagagggggccgctggtgaccgcccg
gtggaagaagtggggcttccagtcgcggttgaaggagccggagggcgacgtcgcccgggactgccagcgcctggtgggct
tgctgagctcgcggctcgtggggcagcaccgtgcctggctggaggctcagggcggctgggtgagcacgcggaggaggacg
tggggcgggatgggcacctgggaagggcccgccaggtggggtatttttctcctgtgcctattaaatgacctcctactcgc
tggcatggagaaaactgctggtcccggttttcctgtcatggttgttaacagcagcattcatctacttctggacacgataa
ttaggagttttaaaatttttagcccacttctgcctgcccaactgtga
>gnl|bcl2dbcds|A0A2K6TLM0_BCL2A1-03 BCL2-related protein A1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2A1 (length=489 residues).
atgacagaccacgaatttggatatattcacaatctaactcaggactatctgcggtatgtcctgcagataccacaatctgg
aacgggtccaagcaaaacgtccagagtactacaaaaggttgcattctcagtccaaaaggaagtggaagagagtctgaagc
catgcttggacaacgttcatattgtgtccatggacaatgccagaacaatattcagtcaagtgatggaaaaggaatttgaa
gatggcattattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgagagcg
aattgccccggatgtggatacttacaaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taagacgaaacggaggctgggggaaatggaacagtctcatgcttatgctagtggagtcagcgcagaagaagaagaaaatg
gctttgtaa
>gnl|bcl2dbcds|A0A2K6TLM0_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2A1 (length=528 residues).
atgacagaccacgaatttggatatattcacaatctaactcaggactatctgcggtatgtcctgcagataccacaatctgg
aacgggtccaagcaaaacgtccagagtactacaaaaggttgcattctcagtccaaaaggaagtggaagagagtctgaagc
catgcttggacaacgttcatattgtgtccatggacaatgccagaacaatattcagtcaagtgatggaaaaggaatttgaa
gatggcattattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgagagcg
aattgccccggatgtggatacttacaaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taagacgaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctatctctcttgaagcaatactactga
>gnl|bcl2dbcds|A0A2K6TLM0_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2A1 (length=435 residues).
atgacagaccacgaatttggatatattcacaatctaactcaggactatctgcggtatgtcctgcagataccacaatctgg
aacgggtccaagcaaaacgtccagagtactacaaaaggttgcattctcagtccaaaaggaagtggaagagagtctgaagc
catgcttggacaacgttcatattgtgtccatggacaatgccagaacaatattcagtcaagtgatggaaaaggaatttgaa
gatggcattattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgagagcg
aattgccccggatgtggatacttacaaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taagacgaaacggaggctgggacctatcgcaatag
>gnl|bcl2dbcds|A0A2K6TM77_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaacttttccaagggggtcccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacaggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A2K6TM77_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L2 (length=615 residues).
catctttcatccttgcctcttatagccgcccggatggcgaccccagcctcagccccagacacacgggctctggtggcaga
ctttgtaggttataagctgaggcagaagggttatgtctgtggagctggccccggggagggcccagcagctgacccgctgc
accaagcaatgcgggcagctggagatgagttcgagacccgcttccggcgcaccttctctgatctggcggctcagctgcat
gtgaccccaggctcagcccaacaacgcttcacccaggtctccgatgaacttttccaagggggtcccaactggggccgcct
tgtagccttctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgc
aggagtggatggtggcctacctggagacgcggctggccgactggatccacagcagtgggggctgggcggagttcacagct
ctatacggggacggggccctggaggaggcgcggcgtctgcgggaggggaactgggcatcagtgaggacagtgctgacagg
ggccgtggcactgggggccctggtaactgtaggggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A2K6TM77_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L2 (length=1041 residues).
atggcgaccccagcctcagccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaacttttccaagggggtcccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggccgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggaactacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggaccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagacgagtccctatttagaggacg
gcaaatcaaggttgactttaaggctttcatttattcatctctgactcaggtgatcccaaaacgaaccaacagaccaggca
tcagcacaacagaccggggttttccacgagcccgctaccgcgcacggaccaccaactacaacagttcccgctctcgattc
tacagtggttttaacagcaggccccggggtcgcgtctacaggggccgggctagagcgacatcatggtattccccttacta
a
>gnl|bcl2dbcds|A0A2K6UEL3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagatgtgggcgccgcgcccccaggcgccgcccccgcgccgggcatcttctcctcccagcccg
ggcacacgcccggtcccgctgcgccccgggaccctgtcgccaggaccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnncagcccagtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccgccg
ctatcgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgaccgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggaactgtatggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagcttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A2K6UWY8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccagcctggcacctggcggacagccccgcggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcaataaagcaagcactgagggaggcaggcgacgagtttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcgtatcaaagctttgaacaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaa
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcagcagccgagagcagaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|A0A2K6UWY8_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L1 (length=441 residues).
atgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatgctccacat
cacccccgggacagcgtatcaaagctttgaacaggtagtgaacgaactcttccgggatggggtgaactggggtcgcattg
tggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaagtattggtgagtcggatcgca
gcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaact
ctatggaaacaatgcagcagccgagagcagaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtgg
ccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|A0A2K6V5Y3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=MCL-1 (length=1053 residues).
atgttcggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccccccgggagggcggcttctggccgcggagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgctagccctccggccgccctgacgcctgacgcccggagggtcgtgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgcc
gctggaggagatggaagccccggccgccgacgccatcatgtcgcccgaagacgagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagctggtcggggagcctggtcatggctccagtacggacgggtcactc
ccctcgacgccgccgcccgcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtacctccg
ggagcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagcaggaaggcgctggagaccctgc
ggcgggtcggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggtaggattgtgactct
catttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgcattgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggatctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2K6V5Y3_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=MCL-1 (length=813 residues).
atgttcggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccccccgggagggcggcttctggccgcggagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgctagccctccggccgccctgacgcctgacgcccggagggtcgtgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgcc
gctggaggagatggaagccccggccgccgacgccatcatgtcgcccgaagacgagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagctggtcggggagcctggtcatggctccagtacggacgggtcactc
ccctcgacgccgccgcccgcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtacctccg
ggagcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagcaggaaggcgctggagaccctgc
ggcgggtcggggacggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
tctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttgtaa
>gnl|bcl2dbcds|A0A2K6V5Y3_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=MCL-1 (length=594 residues).
atgttcggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccccccgggagggcggcttctggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagca
ggaaggcgctggagaccctgcggcgggtcggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggtaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgca
ttgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggatctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
© 1998-2018