Dataset for CDS BCL2A1 of organism Saimiri boliviensis boliviensis

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A2K6TLM0_BCL2A1-03 BCL2-related protein A1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2A1 (length=489 residues).
atgacagaccacgaatttggatatattcacaatctaactcaggactatctgcggtatgtcctgcagataccacaatctgg
aacgggtccaagcaaaacgtccagagtactacaaaaggttgcattctcagtccaaaaggaagtggaagagagtctgaagc
catgcttggacaacgttcatattgtgtccatggacaatgccagaacaatattcagtcaagtgatggaaaaggaatttgaa
gatggcattattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgagagcg
aattgccccggatgtggatacttacaaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taagacgaaacggaggctgggggaaatggaacagtctcatgcttatgctagtggagtcagcgcagaagaagaagaaaatg
gctttgtaa
>gnl|bcl2dbcds|A0A2K6TLM0_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2A1 (length=528 residues).
atgacagaccacgaatttggatatattcacaatctaactcaggactatctgcggtatgtcctgcagataccacaatctgg
aacgggtccaagcaaaacgtccagagtactacaaaaggttgcattctcagtccaaaaggaagtggaagagagtctgaagc
catgcttggacaacgttcatattgtgtccatggacaatgccagaacaatattcagtcaagtgatggaaaaggaatttgaa
gatggcattattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgagagcg
aattgccccggatgtggatacttacaaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taagacgaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctatctctcttgaagcaatactactga
>gnl|bcl2dbcds|A0A2K6TLM0_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2A1 (length=435 residues).
atgacagaccacgaatttggatatattcacaatctaactcaggactatctgcggtatgtcctgcagataccacaatctgg
aacgggtccaagcaaaacgtccagagtactacaaaaggttgcattctcagtccaaaaggaagtggaagagagtctgaagc
catgcttggacaacgttcatattgtgtccatggacaatgccagaacaatattcagtcaagtgatggaaaaggaatttgaa
gatggcattattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgagagcg
aattgccccggatgtggatacttacaaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taagacgaaacggaggctgggacctatcgcaatag
© 1998-2018