Dataset for CDS Unclassified of organism Ruditapes philippinarum

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|R4TE41_uncBCL2L2-01 Putative BCL2-like 2 gene OS=[Eukaryota] Ruditapes philippinarum (length=567 residues).
atgaggatggacgaggatgacttttcgatcggtactagtggaatagtggcggaatatattacttataaagtacaacaagc
tggatttgattaccaagtctcgccaacaaggaactgccctaataacaaagtaatagacactgtgaagaaactgtgcagcg
agtttgagaaacggtacgagtcgcagtttaccgaaatgtgcgaaacttgctcgcaagttgaattaaattctgcaaattat
gtagctgttttggaccaattaattgtcaacggacttcattggggtagggttgttgcaatattttcatttgcgggtgctat
gtcagtgtactgcatgaaaaagaaccagaaagagagggttgactggatccgagagtggacttgccagttcatggacagta
aagtagaaaactggataaatgaaaataatggatggagaggacttatagatttttacacgaatggcatcaagaaaccagaa
gaaaaaacaaatggatggggatctgttctcatcggtggtgccctcggagcttttgcgctcggtgcgctcataatcaataa
ggcatga
>gnl|bcl2dbcds|R4TGI6_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Ruditapes philippinarum (length=696 residues).
atgacgacaacaagtccaacatacggtggaattaaatcattaggagggaatggaggttttcataacaattcaaatctgtt
cgctgaaattcataaacattggggacttttaccaggaaaccaagggctcaataacatcaaccaggaaacacagacaacag
gttctatgttatcaccattagaaaatgtaagaaaacaggcagagataatagcaacggctgttgttgttaattttggtctt
gactgtgaaaagaaatgtccggacagattctgtaaaacaatgagaaaaacagtgcaagaagtttcagatagacatgacat
agctttgaaatcaatggtcaacaagctgaatcttgatgattctaatatgtttgctacttttgtaaatgttgctgatgaaa
tcttcgaagacggtcaaataaattggggacgagtcattgttgtttacgcgtttgctgccagattaaatgcctactttaga
caaggaaatccaacttacgaagagaagatatctctttatgttggaaagtatgtcggtaataaacttggacgatggatttt
agataatggaggatgggatgcatttgcagactttttctcagatgaaaatgcagtagaggataaaatttggaaaggacttt
tatttacagcaactcttgggggattgggtgcattagcagctgttatgtcccgatga
© 1998-2018