Dataset for CDS Unclassified of organism Rhinolophus gammaherpesvirus 1

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A2Z5U635_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Viruses] Rhinolophus gammaherpesvirus 1 (length=501 residues).
atggacccgcccattatttcgctggtcaccgatgtcatgaaagtcaacctaggggagttggggttcacatggactggaca
tggacctccaatccccggatcccctgaaccacttcaaataccgctcccggtagggtgcctgttggacgcaatgcataaat
gttccggtatgtatagggaaagatttggacccctccttgatcacgcgaacccgcagttgggtgcctacgatatgcaacta
ggattattttcaagcgaactcttccgtgacggggtcaactggggtagaattgtggcatttttttcttttggaagctccat
gggcattaatctagccaagcagggcatcaatcccggacccatgtgccggatgttatctgaaaccttggagagattggctg
gtccgtggattagagaccatgatggatgggacggtttagttgattggtggctgacaagaggagattggtccatctggaac
cttcaatgttcaattctgtaa
© 1998-2019