Dataset for CDS Unclassified of organism Rattus norvegicus

[Download (right click)]

3 sequence(s)

>gnl|bcl2dbcds|E9PU78_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Rattus norvegicus (length=513 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
tagcgatgtcgaagagaacaggactgaagccccagaagaaactgaaccagaaagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagccccgaggtgaatggagccactggccacagcagcagtttggaggcgcgggaggta
atccccatggcagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcggtaccggagagcattcagtga
tctaacatcccagcttcatataaccccagggacagcatatcagagctttgaacaggacacttttgtggatctctacggga
acaatgcagcagccgagagccggaaaggccaggagcgtttcaaccgctggttcctgacgggcatgactgtggctggtgtg
gttctgctgggctcactcttcagtcggaagtga
>gnl|bcl2dbcds|Q7TS61_uncBCL2L2-01 Putative BCL2-like 2 gene OS=[Eukaryota] Rattus norvegicus (length=240 residues).
atggagccattggtgggacaagtgcaggattggatggtgacctacctggagacacgcttggctgactggatccacagcag
tgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcacggcgtctgcgggaggggaactggg
catcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaactgtaggggccttttttgctagcaagtga
>gnl|bcl2dbcds|Q9WUI5_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Rattus norvegicus (length=513 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
tagcgatgtcgaagagaacaggactgaagccccagaagaaactgaaccagaaagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagccccgaggtgaatggagccactggccacagcagcagtttggatgcgcgggaggta
atccccatggcagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcggtaccggagagcattcagtga
tctaacatcccagcttcatataaccccagggacagcatatcagagctttgaacaggacagttttgtggatctctacggga
acaatgcagcagccgagagccggaaaggccaggagcgtttcaaccgctggttcctgacgggcatgactgtggctggtgta
gttctgctgggctcactcttcagtcggaagtga
© 1998-2018