Dataset for CDS MCL-1 of organism Rattus norvegicus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|Q9Z1P3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rattus norvegicus GN=MCL-1 (length=993 residues).
atgtttggccttcggagaaacgcggtaatcggcttgaacctgtactgcggcggcgctagcctcggcgcgggcggcggctc
tccggccgggacgcgcctggcggccgaggaggccaaggcgcggcgcgaggggggaggggaggccgctctgctgcccggcg
cgcgggtggtcgcccggccgcctccggtgggcgccgaggaccccgacgtcaccgcgtcggcagagaggcggctgctcaag
tcgcccggcctcctcgccgtgccgcctgaggagatggccgcgtcggccgccgccatcatgtctcccgaggaggagctgga
cggctgtgagccggaggtgctcagcaaacgcccggcggtgctgcccctactggagcgcgtgagcgaggcggctaagagct
ccggagctgacggctcgctgccctccacgccgccgccgcctgaggaggaagacgacgagctgtaccaccagtcgctggag
atcatctcccgctacctgcgggagcaggcgacgggctccaaggacgcgaagcctctgggcgaggccggcgcagcgggccg
gagggcgctggagaccctgcggcgcgtgggcgacggcgtgcagcgcaaccacgagacggccttccagggcatgcttcgga
aactggacattaaaaacgaggacgatgttaaatctttttctcgagtgatgacccatgttttcaaagatggcgtaacaaac
tggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttaaagagcataaaccaagaaagctgcat
cgaacctttagcagaaagtatcacagacgttcttgtaaggacgaagcgggactggcttgtgaaacaaagaggctgggatg
ggtttgtggagttcttccacgtacaggacctagaaggcggcatcagaaatgtgctgctggcttttgcgggtgttgctgga
gtaggggctggtctggcatatctaataaggtag
© 1998-2018