Dataset for CDS BCL-2-like of organism Rattus norvegicus

[Download (right click)] [Alignment] [Repertoires]

13 sequence(s)

>gnl|bcl2dbcds|F1LNV0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Rattus norvegicus GN=BCL-2 (length=711 residues).
atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatccattataagctgtcacagagggg
ctacgagtgggatactggagatgaagactccgcgcccctgagggctgcccccacccctggcatcttctccttccagcctg
agagcaaccggacgcccgctgtgcaccgagacacggctgccaggacgtcgcctctacggccccttgtcgccaccgctggg
cctgcgctcagccctgtgccacctgtggtccacctgaccctccgccgggctggggatgacttctctcgtcgctaccgtcg
cgactttgcagagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggaac
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcacccctggtggacaacatcgctctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggataacggaggctgggatgcctttgtggaactatatggccccagcatgcgacctctgtttgatttctcctggctgtctc
tgaagacgctgctcagcctggccctggtgggggcctgcatcactctgggtgcatacctgggccacaagtga
>gnl|bcl2dbcds|G3V977_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2A1 (length=528 residues).
atgacagactgtgagttcatgtatatccactccctggctgagaactatcttcagtatgtcctgcaggtacctgcctttga
atcggctccaagcaaaacgtccagagtgctacagagagttgctttctctgtacaaaaggaagttgaaaagaatctgaagc
catacttggatgactttcacgtggaatccatagatactgccagaataatattcaaccaagtgatggaaaaagaatttgaa
gatggcatcattaactggggaaggattgtgactatatttgcctttgggggtgttctcctgaaaaagcttccacaagagca
gattgccctggatgtggatacttacaagcaagtttccagttttgtggcggaattcataatgaataacacaggagaatgga
tacagcagaatggaggctgggaagatggcttcacaaagaagtttgaacctaaatctggctggctgacttttctgcagatg
acagggaagatctgggaaatgctctttctcctcaagcaacactactga
>gnl|bcl2dbcds|O88996_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcaaccccagacacacgggctctagtggctgactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggccctggggaaggcccagcagccgacccgctgcaccaagccatgcgggcagctggagacgagtttg
agacccgcttccggcgcaccttctctgacctggccgctcagctacacgtgaccccaggctcagcccagcaacgcttcacc
caggtttccgacgaacttttccaagggggccccaactggggccgtcttgtggcattctttgtctttggggctgccctgtg
tgctgagagtgtcaacaaagaaatggagccattggtgggacaagtgcaggattggatggtgacctacctggagacacgct
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcacgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|P49950_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Rattus norvegicus GN=BCL-2 (length=711 residues).
atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatccattataagctgtcacagagggg
ctacgagtgggatactggagatgaagactccgcgcccctgagggctgcccccacccctggcatcttctccttccagcctg
agagcaaccgaacgcccgctgtgcaccgagacacggctgccaggacgtcgcctctacggccccttgtcgccaacgctggg
cctgcgctcagccctgtgccacctgtggtccacctgaccctccgccgggctggggatgacttctctcgtcgctaccgtcg
cgactttgcagagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggaac
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggggagcgtcaac
agggagatgtcacccctggtggacaacatcgctctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggataacggaggctgggatgcctttgtggaactatatggccccagcatgcgacctctgtttgatttctcctggctgtctc
tgaagacgctgctcagcctggccctggtgggggcctgcatcactctgggtgcatacctgggccacaagtga
>gnl|bcl2dbcds|Q7TS60_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2L2 (length=660 residues).
atgtccctttttggtctctgtcaatatttttcatatatttatgtcagtctgtcatccttgcccctttcagccgcccggat
ggcgaccccagcctcaaccccagacacacgggctctagtggctgactttgtaggctataagctgaggcagaagggttatg
tctgtggagctggccctggggaaggcccagcagccgacccgctgcaccaagccatgcgggcagctggagacgagtttgag
acccgcttccggcgcaccttctctgacctggccgctcagctacacgtgaccccaggctcagcccagcaacgcttcaccca
ggtttccgacgaacttttccaagggggccccaactggggccgtcttgtggcattctttgtctttggggctgccctgtgtg
ctgagagtgtcaacaaagaaatggagccattggtgggacaagtgcaggattggatggtgacctacctggagacacgcttg
gctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcacggcg
tctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaactgtagggg
ccttttttgctagcaagtga
>gnl|bcl2dbcds|Q7TS62_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2L1 (length=855 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
tagcgatgtcgaagagaacaggactgaagccccagaagaaactgaaccagaaagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagccccgcggtgaatggagccactggccacagcagcagtttggatgcgcgggaggta
atccccatggcagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcggtaccggagagcattcagtga
tctaacatcccagcttcatataaccccagggacagcatatcagagctttgaacaggtagtgaatgaactctttcgggatg
gggtaaactggggtcgcattgtggccttcttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggtaagaaccacgccccttgtgtgtccgccccttgtgtgtctctcctctgtggagatccctaactgccctttttggt
ctcctggcatggttgttgaagatatcgattattcaggagacattcctggcttcactttaataccaggggttaactttggg
aatattgatgaccctgtttttaaggaacctgtatttttcattctggctacccttgtggccccgcagtttcatagttttgt
tccaatttctcggcaaagaaaaacagcctgtgtgtttacttggcttaaaacctag
>gnl|bcl2dbcds|Q7TS62_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
tagcgatgtcgaagagaacaggactgaagccccagaagaaactgaaccagaaagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagccccgcggtgaatggagccactggccacagcagcagtttggatgcgcgggaggta
atccccatggcagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcggtaccggagagcattcagtga
tctaacatcccagcttcatataaccccagggacagcatatcagagctttgaacaggtagtgaatgaactctttcgggatg
gggtaaactggggtcgcattgtggccttcttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggatctctacgggaacaatgcagcagccgagagccggaaaggccaggagcgtttcaaccgctggt
tcctgacgggcatgactgtggctggtgtagttctgctgggctcactcttcagtcggaagtga
>gnl|bcl2dbcds|Q7TS62_BCL2L1-04 BCL2-like 1 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2L1 (length=699 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
tagcgatgtcgaagagaacaggactgaagccccagaagaaactgaaccagaaagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagccccgcggtgaatggagccactggccacagcagcagtttggatgcgcgggaggta
atccccatggcagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcggtaccggagagcattcagtga
tctaacatcccagcttcatataaccccagggacagcatatcagagctttgaacaggtagtgaatgaactctttcgggatg
gggtaaactggggtcgcattgtggccttcttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggtaagaaccacgccccttgtgtgtccgccccttgtgtgtctctcctctgtggagatccctaactgccctttttggt
ctcctggcatggttgttgaagatatcgattattcaggagacattcctggctcactttaa
>gnl|bcl2dbcds|Q7TS62_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2L1 (length=855 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
tagcgatgtcgaagagaacaggactgaagccccagaagaaactgaaccagaaagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagccccgcggtgaatggagccactggccacagcagcagtttggatgcgcgggaggta
atccccatggcagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcggtaccggagagcattcagtga
tctaacatcccagcttcatataaccccagggacagcatatcagagctttgaacaggtagtgaatgaactctttcgggatg
gggtaaactggggtcgcattgtggccttcttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggtaagaaccacgccccttgtgtgtccgccccttgtgtgtctctcctctgtggagatccctaactgccctttttggt
ctcctggcatggttgttgaagatatcgattattcaggagacattcctggcttcactttaataccaggggttaactttggg
aatattgatgaccctgtttttaaggaacctgtatttttcattctggctacccttgtggccccgcagtttcatagttttgt
tccaatttctcggcaaagaaaaacagcctgtgtgtttacttggcttaaaacctag
>gnl|bcl2dbcds|Q7TSN8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Rattus norvegicus GN=BCL-2 (length=711 residues).
atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatacattataagctgtcacagagggg
ctacgagtgggatgctggagatgcggacgcggcgcccctgggggctgcccccacccctggcatcttctccttccagcctg
agagcaacccaatgcccgctgtgcaccgggacatggctgccaggacgtctcctctcaggcccctcgttgccaccgctggg
cctgcgctcagccctgtgccacctgtggtccatctgaccctccgccgggctggggatgacttctctcgtcgctaccgtcg
tgacttcgcagagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggaac
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcacccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggataacggaggctgggatgcctttgtggaactatatggccccagcatgcgacctctgtttgatttctcctggctgtctc
tgaagaccctgctcagcctggccctggtcggggcctgcatcactctgggtgcatacctgggccacaagtga
>gnl|bcl2dbcds|Q925A9_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2A1 (length=528 residues).
atgacagactgtgagttcatgtatatccactccctggctgagaactatcttcagtatgtcctgcaggtacctgcctttga
atcggctccaagcaaaacgtccagagtgctacagagagttgctttctctgtacaaaaggaagttgaaaagaatctgaagc
catacttggatgactttcacgtggaatccatagatactgccagaataatattcaaccaagtgatggaaaaagaatttgaa
gatggcatcattaactggggaaggattgtgactatatttgcctttgggggtgttctcctgaaaaagcttccacaagagca
gattggcctggatgtggatacttacaagcaagtttccagttttgtggcggaattcataatgaataacacaggagaatgga
tacagcagaatggaggctgggaagatggcttcacaaagaagtttgaacctaaatctggctggctgacttttctgcagatg
acagggaagatctgggaaatgctctttctcctcaagcaacactactga
>gnl|bcl2dbcds|Q99M66_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2L10 (length=558 residues).
atgggtgacccgctgcaggatcgcactagacggctgctgactgactacatattgttctgcgcacgggcgccgaacacccc
tgagccactgcccacgtctgttgaggcggccttgctgcgctctgtgactagtcagatccaacaggagcaccaggatcttt
tcaactccttccgcgactaccagggcaaccgcctggagctggtgacacagatggcggatgagttgctctccaatgaccaa
gagttcaactggggccgcctggtgatgctcctggccttcgtggggacgctaatgaaccaagacaggactgttaagcggag
gagggatcaaagaaaccgtctcctactggagcgagactgctatctcatagtgagcttgctgtacaatcgactcacaggac
ggcatcgctcctggctggaggctcacggtggctgggatggcttttgccaattcttcaagaaccccttaccacccggcttc
tggagaagattgctgatccgggctattctgtcctgtttctttgcaacggccatcttttatatctggaaatgtttataa
>gnl|bcl2dbcds|Q9Z1P3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rattus norvegicus GN=MCL-1 (length=993 residues).
atgtttggccttcggagaaacgcggtaatcggcttgaacctgtactgcggcggcgctagcctcggcgcgggcggcggctc
tccggccgggacgcgcctggcggccgaggaggccaaggcgcggcgcgaggggggaggggaggccgctctgctgcccggcg
cgcgggtggtcgcccggccgcctccggtgggcgccgaggaccccgacgtcaccgcgtcggcagagaggcggctgctcaag
tcgcccggcctcctcgccgtgccgcctgaggagatggccgcgtcggccgccgccatcatgtctcccgaggaggagctgga
cggctgtgagccggaggtgctcagcaaacgcccggcggtgctgcccctactggagcgcgtgagcgaggcggctaagagct
ccggagctgacggctcgctgccctccacgccgccgccgcctgaggaggaagacgacgagctgtaccaccagtcgctggag
atcatctcccgctacctgcgggagcaggcgacgggctccaaggacgcgaagcctctgggcgaggccggcgcagcgggccg
gagggcgctggagaccctgcggcgcgtgggcgacggcgtgcagcgcaaccacgagacggccttccagggcatgcttcgga
aactggacattaaaaacgaggacgatgttaaatctttttctcgagtgatgacccatgttttcaaagatggcgtaacaaac
tggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttaaagagcataaaccaagaaagctgcat
cgaacctttagcagaaagtatcacagacgttcttgtaaggacgaagcgggactggcttgtgaaacaaagaggctgggatg
ggtttgtggagttcttccacgtacaggacctagaaggcggcatcagaaatgtgctgctggcttttgcgggtgttgctgga
gtaggggctggtctggcatatctaataaggtag
© 1998-2018